PE-conjugated mouse IgG1 (Pharmingen) was used as the isotype control antibody. The cells were washed and resuspended twice in a staining buffer (PBS containing 3% FCS and 0·02% 1 M sodium azide), and then analysed on a fluorescence activated cell sorter (FACScan) cytometer R428 (Becton Dickinson, Mountain View, CA, USA). At least 10 000 events were acquired from each sample and were analysed subsequently using Lysis II and CellQuest software (Becton Dickinson).

The SLE T cells were analysed for FasL and Fas mRNA expression by semi-quantitative RT–PCR [17]. Briefly, after stimulation of T cells with PMA plus ionomycin for 6 h, the mRNA was extracted from the cells using RNAzol B according to the manufacturer’s instructions (Biotec Laboratories, Houston, TX, USA). The RNA was converted to cDNA using SuperscriptII RT (Gibco BRL, Gaithersburg, MD, USA), 10 mM 2′-deoxynucleoside 5′-triphosphate (dNTP), 0·1 M dithiothreitol (DTT), RNase inhibitor (Rnasin, Toyobo, Osaka, Japan) and random hexamer Fulvestrant oligonucleotide priming (Gibco BRL). The PCR

amplification of the cDNA aliquots was performed by adding 2·5 mM dNTPs, 2·5 U Taq DNA polymerase (Boehringer, Mannheim, Germany) and 0·25 µM each of the sense and anti-sense primers. The reaction was performed in PCR buffer (1·5 mM MgCl2, 50 mM KCl, 10 mM Tris HCl, pH 8·3) with a total final volume of 25 µl. The following sense and anti-sense primers for FasL, Fas and glyceraldehydes-3-phosphate-dehydrogenase Anacetrapib (GAPDH) were used (5′3′ direction): FasL sense GCCTGTGTCTCCTTGTGA, FasL anti-sense GCCACCCTTCTTATACTT; Fas sense CAAGTGACTGACATCAACTCC, Fas anti-sense CCTTGGTTTTCCTTTCTGTGC; GAPDH sense CGATGCTGGGCGTGAGTAC, GAPDH anti-sense CGTTCAGTCCAGGGATGACC.

The reactions were processed in a DNA thermal cycler (Hybaid, Teddington, UK) under the following conditions: 1 min of denaturation at 94°C; 30 s of annealing at 63°C for FasL, 1 min at 57°C for Fas and 1 min at 55°C for GAPDH; and 1 min elongation at 72°C. PCR cycles were repeated 34 times for FasL, 34 times for Fas and 28 times for GAPDH, values which had been determined previously to fall within the exponential phase of amplification for each molecule. Reaction products were run on a 1·5% agarose gel and stained with ethidium bromide. Expression levels of mRNA are presented as a ratio of the FasL product to GAPDH product. The data are expressed as mean ± standard deviation (s.d.). Comparisons of the numerical data between the groups were performed using a Mann–Whitney U-test. Probability (P) values less than 0·05 were considered statistically significant. As indicated in Fig. 1a, apoptosis of SLE T cells was observed at high levels 24 h after the treatment with PMA plus ionomycin, as determined using a cellular DNA fragmentation ELISA.