Activation of AMPK-induced autophagy ameliorates Huntington disease pathology invitro

Carolin Walter a, b, Laura E. Clemens a, b, c, Amelie J. Müller d, Petra Fallier-Becker e, Tassula Proikas-Cezanne d, Olaf Riess a, b, Silke Metzger a, b, 1, Huu Phuc Nguyen a, b, *, 1

Abstract

The expansion of a polyglutamine repeat in huntingtin (HTT) causes Huntington disease (HD). Although the exact pathogenesis is not entirely understood, mutant huntingtin (mHTT) causes disruption of various cellular functions, formation of aggregates and ultimately cell death. The process of autophagy is the main degradation pathway for mHTT, and various studies have demonstrated that the induction of autophagy leads to an amelioration of aggregate formation and an increase in cell viability. Commonly, this is achieved by inhibition of the mammalian target of rapamycin (mTOR), a prominent regulator of cell metabolism. Alternatively, non-canonical AMPK or mTOR-independent autophagy regulation has been recognized. Given mTOR’s involvement in major cellular pathways besides autophagy, its inhibition may come with potentially detrimental effects. Here, we investigated if AMPK activation may provide a target for the induction of autophagy in an mTOR-independent manner. We demonstrate that activation of AMPK by A769662 and overexpression of a constitutively active form of AMPKa in STHdh cells and mouse embryonic fibroblasts (MEFs), leads to increased expression of the autophagosomal markers LC3 and p62, suggesting efficient autophagy induction. The induction of autophagy was independent of mTOR, and accompanied by a decrease of mHTT-containing aggregates as well as improved cell viability.
Therefore, we validated AMPK as a promising therapeutic target to treat HD, and identified A769662 as a potential therapeutic compound to facilitate the clearance of mHTT.

Keywords:
Huntington disease
Huntingtin
AMPK
Autophagy mTOR independent

1. Introduction

Macroautophagy, herein referred to as autophagy, is the most important degradation pathway in cells, besides the proteasomal degradation system (Ciechanover, 2005). Cellular components, which have to be degraded and may consist of long-lived proteins, protein complexes, damaged organelles and even pathogens, are engulfed by a double membrane structure, the so-called autophagosome, are degraded by the lysosomal degradation pathway (Dunn, 1994). Via macroautophagy, cell constituents can be recycled, viruses or bacteria can be rendered harmless, and the cells can get rid of disturbing and ultimately toxic substances (Yuk et al., 2012).
Thus, the autophagic system is of major importance for maintaining proper cell function especially in non-regenerating cells such as neurons (Mehrpour et al., 2010). Defective or ineffective autophagic degradation has been shown to be associated with numerous diseases such as cancer, viral and bacterial infections, and, as discovered more recently, with neurodegenerative diseases (Qu et al., 2003; Liang et al.,1998; Levine, 2005; Rubinsztein, 2006). Especially in neurodegenerative diseases characterised by the formation of protein aggregates, such as tauopathies or polyglutamine (polyQ) diseases including Huntington Disease (HD), autophagy holds an important role regarding the depletion of toxic aggregation products (Ravikumar et al., 2002).
HD is a progressive neurodegenerative disease which is associated with motor dysfunction, psychiatric disturbances and cognitive decline. The disease is caused by an expanded CAG repeat in the huntingtin gene (The Huntington’s Disease Collaborative Research Group, 1993), which translates into an elongated polyQ stretch in the huntingtin protein (HTT), and which results in functional changes of the protein, as well as misfolding and aggregation in nucleus and neuronal processes (Vonsattel et al.,1998). Due to the large protein size and the presence of the polyQ stretch in mutant huntingtin (mHTT), both soluble and aggregated forms are mainly degraded by the autophagosomal degradation pathway (Ravikumar et al., 2002). Several studies have shown that the induction of autophagy leads to a decrease in soluble and aggregated mHTT, as well as a reduction of mHTT-mediated cytotoxicity in HD cell and animal models (Ravikumar et al., 2004; Sarkar et al., 2005).
In these studies, the induction of autophagy was most frequently evoked by inhibition of the mammalian target of rapamycin (mTOR), the major negative regulator of autophagy, via rapamycin (Ravikumar et al., 2004). However, several studies have reported a dysregulation of the mTOR signalling pathway in different HD cell and animal models that has been interpreted as a survival mechanism of the affected cells (Xifro et al., 2011; Gines et al., 2003). Therefore, mTOR might not provide the best target for autophagy induction, and a non-canonical mTOR-independent (Codogno et al., 2011) strategy should be considered for therapeutic approaches.
In this regard, AMP-activated kinase (AMPK), a major energy sensor (Steinberg and Kemp, 2009), might provide a potential alternative as a target for autophagy induction. AMPK is composed of a heterotrimeric structure, in which the a-subunit exhibits catalytic, and the be and g-subunits possess regulatory function (Xiao et al., 2011). AMPK can be activated by different upstream kinases and by phosphorylation of its catalytic a-subunit at its Thr172 residue (Carling et al., 2008).
Besides its key role in metabolism, AMPK has been shown to regulate autophagy. The activation of AMPK induces autophagy in two different ways, on the one hand by inhibition of mTORC1 (Inoki et al., 2003; Dubbelhuis and Meijer, 2002) and on the other hand by phosphorylating the mammalian homologue of ATG1, the Unc-51like autophagy activating kinase 1 (ULK1) (Egan et al., 2011; Meijer and Codogno, 2011). Activation of AMPK by the compounds metformin and resveratrol has been shown to have neuroprotective effects, and metformin even prolonged the life span and improved the motor phenotype in an HD mouse model (Ma et al., 2007; Kumar et al., 2006). Additionally, the two substances neferine and onjisaponin B has been shown to induce autophagy by activating AMPK in an mTOR dependent manner and to improve HD phenotypes in PC12-cells (Wong et al., 2015; Wu et al., 2013).
Using two different HD cell models and automated highthroughput autophagy assessments (Thost et al., 2015) we analysed the relationship between AMPK activation, either by using the small molecule A769662 or by overexpressing a constitutively active form of AMPKa, and autophagy in an mTOR independent manner. We demonstrate that AMPK activation leads to autophagy induction in the absence of altered mTOR activity, a decrease in mHTT aggregation, and a subsequent increase in cell viability. Thus, targeting AMPK may provide a promising therapeutic strategy to mediate mHTT clearance for HD without interfering with mTOR signalling.

2. Materials and methods

2.1. Expression constructs

For HTT overexpression, a HTT exon1 construct with 19 or 51 Q was cloned in the vector pEGFP-N1 (Clontech Laboratories, Mountain View, CA, USA) using XhoI and HindIII, in the vector pcDNA 3.1/V5-His (Life Technologies, Carlsbad, California, USA) via NotI and XbaI.
For the overexpression of the constitutively active form of AMPKa, the first 936 bp of PRKAA1 were cloned into the vector pcDNA 3.1/V5-HisA (Life Technologies, Carlsbad, California, USA) using XhoI and HindIII.

2.2. MEF cells

For the preparation of MEFs, a heterozygous breeding of HdhQ111 knock-in mice was set up and maintained for 48 h. After 12 days, the pregnant female was sacrificed by inhalation of CO2. The embryos were extracted by caesarean sectioning, decapitated immediately, and placed individually in sterile, ice-cold, phosphatebuffered saline (PBS). Limbs, brain and visceral organs were removed and a small piece of tissue was stored at 4 C for genotyping. The remaining tissue was transferred into a sterile well of a 6-well plate with fresh PBS. The tissue was washed once with fresh PBS, and then replaced by 2 ml of culture media (Dulbecco’s Modified Eagle Medium (DMEM), 1% penicillin/streptomycin (P/S), 10% fetal calf serum (FCS)). The tissue was incubated for 1 h at 37 C and 5% CO2. Thereafter, the tissue was transferred into a 100 mm dish with 10 ml culture media (pre-warmed to 37 C), and minced with a scalpel. The pieces were then transferred to the bottom of a standard 75 ml cell culture flask with 10 ml of fresh media and incubated undisturbed at 37 C and 5% CO2 for 3 days. Afterwards, media were changed and the cells were incubated until they reached 90% confluence. Cells were then removed from the flask and separated by trypsination (1 ml 0.25% trypsin for 5 min at 37 C and 5% CO2) and gentle disruption with a 1 ml pipette, and half the volume was transferred into a new flask with fresh, pre-warmed media. For the experiments, a WT and a homozygous culture were picked. Experiments were carried out using passages 2e9.

2.3. STHdh cells

STHdh cell lines are immortalized striatal progenitor cells, deriving either from HdhQ111 knock-in mice (STHdhQ111/Q111) or from WT mice with 7 CAG repeats in the endogenous mouse huntingtin gene (Hdh) (STHdhQ7/Q7). STHdh cell lines were purchased from Coriell Cell Repositories (Coriell Institute for Medical Research, Camden, New Jersey, USA) and originated from the laboratory of Dr. Marcy MacDonald (Harvard Medical School, Boston). Passages 4e12 were used for the experiments.

2.4. HEK293T cells

Human embryonic kidney (HEK) cells from line 293 (HEK293T) were used in the passages 25e35 for the experiments.

2.5. Cell handling and treatment

STHdh, MEF and HEK293T cells were maintained in DMEM supplemented with 10% FCS and 1% P/S at 37 C in 5% CO2. STHdh media was additionally complemented by adding 1% geneticin (A2912, Biochrome, Berlin, Germany). For the experiments, STHdh cells were differentiated into neuron-like cells using a differentiation cocktail previously described (Trettel et al., 2000). Transient transfections with HTT-exon1-pcDNA 3.1/V5-His or HTT-exon1-eGFP constructs with different polyQ lengths (19 Q, 51 Q) or PRKAA1-pcDNA 3.1/V5-His were performed using the Attractene transfection reagent (QIAGEN, Venlo, Netherlands) for HEK293 cells, Lipofectamine® 2000 (Life Technologies, Carlsbad, California, USA) for STHdh and Neuromag™ (Nanotherics Ltd., Staffordshire, UK) for MEF cells, following manufacturer’s instructions. Different transfection reagents were chosen according to best transfection efficiencies for the individual cell lines. The incubation time amounted to 72 h for HTT, and 48 h for AMPK expression constructs. For transient co-transfection, the cells were first transfected with the HTT construct, and 24 h later with the AMPK construct, followed by an incubation time of 48 h before the start of the experiments.

2.6. Western blotting and immunodetection

To obtain protein lysates, cells were seeded on 100 mm plates. After reaching a confluence of 80%, the cells were scraped off the plates, lysed in RIPA buffer (50 mM Tris-HCl pH 7.5, 150 mM NaCl, 1% NP-40, 0.5% sodium deoxycholate, 0.1% SDS), containing the protease inhibitor cOmplete (Roche, Basel, Switzerland) and, for phosphorylation analysis, the phosphatase inhibitor phosSTOP (Roche, Basel, Switzerland). Protein concentration was measured spectrophotometrically using Bradford reagent (Bio-Rad Laboratories, Hercules, California, USA).
Western blotting was performed following standard protocols. Antibodies were used at the following dilutions: LC3 (1:200, clone 5F10, NanoTools, Teningen, Germany), mTOR (1:1000, #2972, Cell Signalling, Cambridge, UK), Phospho-mTOR (Ser2448) (1:1000, #2971, Cell Signaling, Cambridge, UK), p70 S6 Kinase (1:1000, 49D7, #2708, Cell Signalling, Cambridge, UK), Phospho-p70 S6 Kinase (Thr389) (1:1000, #9205, Cell Signalling, Cambridge, UK), S6 Ribosomal Protein (1:1000, 54D2, #2317, Cell Signalling, Cambridge, UK), Phospho-S6 Ribosomal Protein (Ser235/236) (1:1000, #2211, Cell Signalling, Cambridge, UK), AMPKa (1:1000, 23A3, #2603, Cell Signalling, Cambridge, UK), Phospho-AMPKa (Thr172) (1:1000, 40H9, #2535, Cell Signalling, Cambridge, UK), Acetyl-CoA Carboxylase (1:1000, C83B10, #3676, Cell Signalling, Cambridge, UK), Phospho-Acetyl-Carboxylase (Ser79) (1:1000, #3661, Cell Signalling, Cambridge, UK), p62 (1:1000, #5114, Cell Signalling, Cambridge, UK), GFP (1:1000, sc-8334, Santa Cruz, California, USA), V5 (1:2000, R960-25, Life Technologies, Carlsbad, California, USA), bActin (1:50.000, A5441, Sigma-Aldrich, Saint Louis, Missouri, USA), as well as peroxidase-conjugated secondary antibodies sheep antimouse (1:3000; NA931; GE Healthcare Biosciences, Chalfont Saint Giles, UK) and donkey anti-rabbit (1:3000; NA934; GE Healthcare Biosciences, Chalfont Saint Giles, UK). Chemiluminescence signals were detected with the LI-COR ODYSSEY® FC Imaging system (LICOR Biosciences, Lincoln, NE, USA), and quantified by densitometry using ODYSSEY® Server software version 4.1 (LI-COR Biosciences, Lincoln, NE, USA).

2.7. Autophagy induction and inhibition of mTOR pathway components

Autophagy was induced by 2 h of starvation in Hank’s balanced salt solution (HBSS) containing 10 mM HEPES, or by addition of rapamycin [400 nM] (Millipore, Billerica, Massachusetts, USA) or A769662 [100 mM] (Tocris Bioscience, Bristol, UK) combined with bafilomycin A1 (BafA1) [50 nM] (Sigma-Aldrich, Saint Louis, Missouri, USA) and incubation for 8 h or indicated time point. The mTOR pathway components were inhibited using Dors [60 mM] (Tocris Bioscience, Bristol, UK) for 6 h to inhibit AMPK, PF1 [30 mM] (Tocris Bioscience, Bristol, UK) for 2 h to inhibit p70 S6 kinase or GSK [20 mM] (Tocris Bioscience, Bristol, UK) for 2 h to inhibit PDK1.

2.8. Immunofluorescence staining

Cells were seeded on coverslips, fixed with 4% paraformaldehyde (PFA) and permeabilised with 1% TritonX-100 in PBS, followed by a 1 h blocking step with 10% normal donkey serum (NDS). Non-transfected cells were stained with the primary antibody LC3B (clone 5F10, NanoTools, Teningen, Germany, diluted 1:5), and co-transfected cells were stained with the primary antibody V5 (R960-25, Life Technologies, Carlsbad, California, USA, diluted 1:500), both incubated in PBS containing 1% bovine serum albumin (BSA) for 1 h at room temperature. Afterwards, the cells were incubated with the Cy3-conjugated secondary antibody donkey anti-mouse (715-165-150, Jackson ImmunoResearch Laboratories Inc., West Grove, PA, USA, diluted 1:300) for 1 h at room temperature. Cells were mounted using VECTASHIELD® Mounting Media (Vector Laboratories Inc., Burlingame, CA, USA) with 40,6Diamidin-2-phenylindol (DAPI) for nuclei staining. Images were acquired using a Zeiss Axioplan microscope (Pl 10x ocular, PlanNEOFLUAR 63x/0.75 objective, AxioCam MRc) and Axiovision 4.8 software (Zeiss, Jena, Germany). Cells containing mHTT aggregates were counted on 30 pseudo-randomized pictures per experiment, and the average from 3 independent experiments was calculated.

2.9. PathScan® akt signalling antibody array kit

The assay was performed in accordance with the manufacturer’s protocol (Cell Signalling, Cambridge, UK). Briefly, proteins were isolated with cell lysis buffer containing the protease inhibitor phosSTOP (Roche, Basel, Switzerland), and the protein concentration was determined using a Bradford assay (Bio-Rad Laboratories, Hercules, California, USA). Samples were diluted to a final concentration of 1 mg/ml, and 75 ml were added to the assay plate. Samples were washed, and the chemiluminescence signals were detected with LI-COR ODYSSEY® FC (LI-COR Biosciences, Lincoln, NE, USA) and quantified with ODYSSEY® Server software version 4.1 (LI-COR Biosciences, Lincoln, NE, USA).

2.10. Quantitative real time PCR

RNA was isolated from cells using RNeasy Mini Kit (QIAGEN, Venlo,Netherlands).RNAconcentrationandqualitywasdetermined by measuring the optical density (BioPhotometer, Eppendorf, Hamburg, Germany). The synthesis of cDNA was performed using the Transcriptor First Strand cDNA Synthesis Kit (Roche, Basel, Switzerland). Quantitative RT-PCR (qRT-PCR) was performed using the LightCycler TaqMan Master Kit (Roche, Basel, Switzerland), and was analysed in triplicates with the LightCycler 480 system (Roche, Basel, Switzerland). LC3B was analysed using the following primers 50AGCAGCACCCCACCAAGA30 and 50GTGGTCAGGCACCAGGAACT30, ATP5B and Eif4a2 served as reference genes, and were amplified using the primer pairs 50GGCACAATGCAGGAAAGG30 and 50TCAGCAGGCACATAGATAGCC30forATP5B,and50GCCAGGGACTTCA CAGTTTC30 and 50TTCCCTCATGATGACATCTCTTT30 for Eif4a2.

2.11. Electron microscopy

For conventional electron microscopy, autophagy was induced and cells fixed with 2.5% glutaraldehyde (Paesel-Lorei, Frankfurt, Germany) in 0.1 M cacodylate buffer (pH 7.4) over night. Thereafter, cells were stored in cacodylate buffer until they were further processed as previously described (Wolburg-Buchholz et al., 2009).

2.12. Viability assays

Cell viability was determined using the PrestoBlue® cell viability reagent (Life Technologies, Carlsbad, California, USA), which is modified by living cells, becoming highly fluorescent. Cell death was determined using the Cytotoxicity Detection Kit (Roche, Basel, Switzerland), which measures the amount of LDH released into the cell culture media. Both assays were performed according to the manufacturer’s instructions. Briefly, 10,000 cells were seeded in a 96-well plate and incubated for 24 h. Autophagy was induced. Six hours later, culture media were transferred into a new 96-well plate for the LDH assay. Cells left in the original plate received fresh media containing treatment and PrestoBlue® reagent. Fluorescence intensity (PrestoBlue® assay) was measured after 7, 9, 24, 33 and 48 h, and absorption (LDH assay) was measured after 6 h, using the plate reader MWGt Synergy HT (BioTek Instruments, Winooski, VT, USA) and the software Gen5 2.01 (BioTek Instruments, Winooski, VT, USA).

2.13. Filtertrap assay

Cells were seeded in 6-well plates, lysed in RIPA buffer and homogenised subsequently using a Dounce homogenizer (Thermo Fisher Scientific, Waltham, MA, USA). Protein concentration was determined in a Bradford assay (Bio-Rad Laboratories, Hercules, California, USA). Samples were diluted to a final concentration of 50 mg in PBS and supplemented with 2% SDS. A total volume of 100 ml of sample was sucked through a nitrocellulose membrane with 0.45 mM pore size, using a vacuum pump. SDS-insoluble protein was retained on the membrane and subsequently detected with 1C2 anti-polyQ antibody (1:2000, Mab1574, clone 5TF11C2, Millipore, Billerica, Massachusetts, USA) and a peroxidaseconjugated secondary sheep anti-mouse antibody (1:3000; NA931; GE Healthcare Biosciences, Chalfont Saint Giles, UK). Chemiluminescence was detected with LI-COR ODYSSEY® FC (LICOR Biosciences, Lincoln, NE, USA) and quantified with ODYSSEY® Server software version 4.1 (LI-COR Biosciences, Lincoln, NE, USA).

2.14. p62 assay

Cells were seeded in a density of 10,000 cells on 96-well plates, autophagy was induced for 2 h and the cells were differentiated in case of STHdh cells. After this, cells were fixed with 3.7% PFA, and incubated in blocking solution (PBS containing 0.1% Tween20 and 1% BSA) overnight at 4 C. Punctae of p62 were stained using p62/ SQSTM1 antibody (1:150, MAB8028, R&D Systems, Minneapolis, MN, USA) and Alexa Fluor® 488 goat anti-mouse-conjugated secondary antibody (A11001, Life Technologies, Carlsbad, California, USA, diluted 1:200). Nuclei were stained with DAPI (0.1 mg/ml, AppliChem, Darmstadt, Germany). Analysis was performed with IN Cell Analyzer 1000 (GE Healthcare Biosciences, Chalfont Saint Giles, UK).

2.15. Statistical analysis

Data were graphed and statistically analysed using GraphPad Prism 6.00 for Windows (GraphPad Software Inc., La Jolla, California, USA). The comparison of two groups was performed with an unpaired Student’s t-test (PRKAA1 filtertrap assay), the comparison of more of than two groups was made with one-way ANOVA and Dunnett’s post-test for multiple comparisons (LDH, p62 assay and filtertrap treatment assays), and longitudinal comparisons were made using a two-way ANOVA and Sidak’s or Tukey’s post-test for multiple comparisons. The significance threshold was set to p < 0.05. Data are presented as group mean ± standard deviation (SD).

3. Results

3.1. Autophagosome formation is increased in HD cells

First, we measured LC3II expression to analyse the autophagosomal activity in STHdh cells and mouse embryonic fibroblasts (MEFs), which both derive from the HdhQ111 knock-in mouse model of HD. In accordance with previous studies in different HD models (Heng et al., 2010; Martinez-Vicente et al., 2010), LC3II expression was increased in both cell models compared to wild type (WT) controls in this study (Fig.1 and Suppl. Fig.1). Western blot analysis revealed that STHdhQ111/Q111 (F1, 16 ¼ 27,26 p ¼ 0,0313) and MEFQ111/ Q111 (F1, 16 ¼ 10,31 p ¼ 0,0171) cells showed a significant increase in the protein expression level of LC3II after inhibition of autophagosomal degradation by bafilomycin A1 (BafA1), which was further enhanced in STHdh cells after induction of autophagy by 2 h of starvation (p ¼ 0,0082) (Fig. 1A and B). Furthermore, this observation was accompanied by a significant increase in LC3B mRNA expression in STHdhQ111/Q111 cells in the presence or absence of autophagy inducing-treatments (F1, 12 ¼ 48,11 prapamycin ¼ 0,0142; pHBSS ¼ 0,0291; pDMSO ¼ 0,0004) (Fig. 1C). The results were further supported by immunofluorescence staining of LC3B in STHdh (Fig.1D) and MEF cells (Suppl. Fig.1C). In the presence of rapamycin or DMSO-containing media, the number of LC3-containing punctae increased in mHTT-expressing cells, resulting in a dramatic increase of these structures after inhibition of autophagosomal degradation with BafA1.

3.2. Despite enhanced autophagosome formation, mTOR activity is increased in HD cells

Autophagy induction is commonly associated with inhibition of mTOR activity. Analysing the expression and phosphorylation levels of mTOR and its target p70 S6 kinase in mHTT-expressing STHdh (Fig. 2AeC) and MEF cells (Suppl. Fig. 2) by Western Blot analyses and with the PathScan® Akt Signaling Antibody Array Kit, we detected increased levels of phosphorylated mTOR, which correlated with a higher mTOR activity (FWB1,16 ¼ 20,05, pWB ¼ 0,0131; F®PathScan 1,8 ¼ 35,75 p®PathScan ¼ 0,0014), as reflected by higher levels of the phosphorylated form of p70 S6 kinase (pWB ¼ 0,0324; p®PathScan ¼ 0,0280).

3.3. Inhibition of AMPKa by dors decreases autophagy in an mTORindependent manner in STHdhQ111/Q111 cells

An increased activity of the mTOR pathway has been interpreted as part of a survival mechanism of mHTT expressing cells (Gines et al., 2003). Therefore, we aimed at inducing autophagy without directly interfering with mTOR activity. We investigated the inhibitory effects on autophagy in response to blocking different steps of the mTOR pathway, which are closely related but not directly linked to mTOR activity.
Specific inhibition of AMPK by the small substance dorsomorphin dihydrochloride (Dors) evoked a blockage in autophagosome formation as treatment with BafA1 did not lead to an increase of LC3II levels in both STHdhQ7/Q7 and STHdhQ111/Q111 (Fig. 3A and B)Q7(F3, 16 ¼ 105,5Q111/Q111pQ7/Q7STHdh and pQ111/Q111STHdh DorsþBafA1 ¼< 0,0001) and MEFQ7/ and MEF cells (Suppl. Fig. 4A and B) after treatment with Dors. These results support the hypothesis that AMPK is directly involved in autophagy induction. Further, mTOR activity was only slightly affected by the treatment with Dors, as hardly any changes in the phosphorylation levels of p70 S6 kinase and the indirect mTOR target S6 ribosomal protein could be observed (Fig. 3C and D and Suppl. Fig. 4C and D). This suggests that a specific inhibition of AMPK only exerts a small effect on mTOR activity.
Inhibition of PDK1 and p70 S6 kinase by their specific inhibitors GSK2334470 (GSK) (inhibits PDK1) and PF4708671 (PF) (inhibits p70 S6 kinase) had no or only small effects on the increase of LC3II expression under BafA1 treatment (Suppl. Fig. 3A, B, E and F and Suppl. Fig. 4E, F, I and J, respectively), but significantly reduced the phosphorylation of S6 ribosomal protein in both examined cell lines (Suppl. Fig. 3C, D, G and H and Suppl. Fig. 4G, H, K and L, respectively) (F STHdh GSK 1, 8 ¼ 35,81, pQ7/Q7STHdh GSK ¼ 0,0019 pQ111/Q111STHdh GSK ¼ 0,00089; F STHdh PF1, 8 ¼ 139,1 pQ111/Q111STHdh PF ¼< 0,0001), corresponding to an inhibitory effect on mTOR activity. Because of this impact on the mTOR pathway, PDK1 and p70 S6 kinase were not considered in further analyses, and the study focused instead on AMPK as possible autophagy-inducing target.

3.4. Activation of AMPKa with A769662 induces autophagy in an mTOR independent manner mainly in STHdhQ111/Q111 cells

As AMPKa seemed to be directly connected to autophagy induction without involvement of mTOR, we aimed at activating the kinase to stimulate autophagy in our cell models. For this purpose, we used a previously described and well-known AMPKa inducer, the small substance A769662. AMPKa activation was monitored by the phosphorylation state of its targets acetyl-CoA-carboxylase (ACC) and ULK1 using Western Blot analysis. The phosphorylated forms of both targets (FACC 1, 8 ¼ 120,9 pQ7/Q7STHdh A769662 ACC ¼ 0,00023 pQ111/Q111STHdh A769662 ACC ¼ 0,0341; FULK1 1, 8 ¼ 7833 pQ111/Q111STHdh A769662 ULK1 ¼ 0,0386) and AMPKa itself increased significantly in STHdhQ7/Q7 Q111/Q111 Q7/Q7 and STHdh cells (F1, 8 ¼ 25,02 pSTHdh A769662 ¼ 0,0462 pQ111/Q111STHdh A769662 ¼ 0,0054) (Fig. 4A and B) after treatment, while total protein levels remained unchanged. In order to examine the effect of AMPKa induction on mTOR activity, phosphorylation of p70 S6 kinase and S6 ribosomal protein were analysed. AMPKa induction by A769662 had no effect on either of the proteins, and thus did not affect mTOR activity. Regarding the autophagyinducing effect by A769662, determined by LC3II and the autophagic marker p62 in the presence or absence of BafA1 (Fig. 4C and D), especially STHdhQ111/Q111 cells showed an increase in p62 (F3, 24 ¼ 6,046, pQ7/Q7STHdh A769662 ¼ 0,1617 pQ111/Q111STHdh A769662 ¼ 0,1266) and LC3II (F3, 24 ¼ 13,15, p ¼ 0,004) expression in the samples treated with A79662 and BafA1 compared to DMSO-treated equivalents, suggesting an increase in autophagosome formation induced by AMPKa activation. This result was supported by qualitative electron microscopy analysis, which revealed an increase in autophagosome-like structures with double membrane and lengths and width of approximately 0.25e0.6 mM and cells upon A769662 or rapamycin treatment (Fig. 5A). Additional to normal autophagosomes, STHdhQ111/Q111 cells showed several empty, double membrane-enclosed vesicles of similar size as the autophagosomes. These structures are likely to be empty autophagosomes, as reported by others (Martinez-Vicente et al., 2010). Also, immunocytochemical analysis confirmed the autophagy-inducing effect of the compound, since a decrease of p62 punctae was detected in STHdhQ7/Q7 (F2, 9 ¼ 1,618 p ¼ 0,0128) and STHdhQ111/Q111 (F2, 9 ¼ 18,67 p ¼ 0,0147) after 3 h of treatment (Fig. 5B and C).
Interestingly, as described for skeletal muscle cells (Steinberg and Kemp, 2009), A769662 treatment did not have such strong effects on the activation of ACC and AMPKa in MEF cells. Here, the most obvious effect was increased phosphorylation of ULK1 (F1, 8 ¼ 1,328 pQ7/Q7MEF A769662 ¼ 0,9893 pQ111/Q111MEF A769662 ¼ 0,3162) (Suppl. Fig. 5A and B), which was accompanied by an induction of autophagy in MEFQ111/Q111 cells (Suppl. Fig. 5C and D and Suppl. Fig. 6 A and B).

3.5. Overexpression of PRKAA1/AMPKa induces autophagy in mHTT-expressing cells

In order to validate the autophagy-inducing effect of AMPKa activation, we overexpressed the constitutively active form of the AMPKa-encoding gene PRKAA1 in STHdh and MEF cells. As it has been shown previously, that this construct upregulates AMPKa kinase activity (Woods et al., 2000). We detected that phosphorylation of ACC (F3, 16 ¼ 0,9989, p ¼ 0,0343), but not ULK1, was increased in PRKAA1-overexpressing STHdhQ111/Q111 cells in presence of BafA1 compared to pcDNA þ BafA1 (Fig. 6A and C). Similar to A769662 treatment (Fig. 4 and 5), PRKAA1 overexpression increased autophagy in STHdhQ111/Q111 cells, as shown by an increase in p62 and LC3II (F3, 16 ¼ 3,982, p ¼ 0,0419) expression in the presence of BafA1 (Fig. 6B and D). This effect could not be detected in STHdhQ7/Q7 cells. MEFQ111/Q111 cells showed a tendency for increased phosphorylation of ACC (F3, 16 ¼ 2,750, @ pULK1Q111/Q111MEF (F3,PRKAA116 ¼¼10,279,,8148 ppQ111/Q111MEFQ111/Q111MEF PRKAA1PRKAA1 þ¼BafA10,3071¼ 0,0290) andpQ111/Q111MEF
PRKAA1 þ BafA1 ¼ 0,4984) by the overexpression of PRKAA1 (Suppl. Fig. 7A and C), accompanied by an increase in autophagosomal activity (F3, 16 ¼ 3,601, p ¼ 0,0280) (Suppl. Fig. 7B and D). The cells after induction of autophagy by A769662 as well as rapamycin. STHdh cells additionally showed empty autophagosomes. Scale bar ¼ 0.25 mm (B) Three hours of A769662 treatment led to the induction of autophagy, as indicated by a decrease in the amount of p62-positive punctae in both STHdhQ7/Q7 and STHdhQ111/Q111 cells, which were counted with the IN Cell Analyzer as illustrated in (C). Values are means ± SEM. Statistics: ANOVA1, Dunnett’s multiple comparisons test (A)*p < 0.05 (B), n ¼ 4 (B). effect of autophagy induction by overexpression of PRKAA1 mainly 3.6. Activation of AMPKa improves cell viability applies to mHTT-expressing cells, which can be expected to have a higher demand for clearance of toxic substances. Autophagy induction has been shown to be beneficial in HD models (Ravikumar et al., 2004). Thus, we investigated the consequences of AMPKa activation by A769662 treatment on cell viability via the PrestoBlue® assay. We detected a consistent improvement of cell viability in WT (F2, 30 ¼ 12,25 prapamycin ¼ 0,0040 pA769662 ¼ 0,0014) and mutant STHdh (F2, 30 ¼ 3,436, p ¼ 0,0228) (Fig. 7A and C) and MEF cells (F Q7/Q7MEF 2, Q111/Q111 30 ¼ 5,181 F MEF 2, 30 ¼ 8,072) (Suppl. Fig. 8A and C) after A769662 treatment. Rapamycin, which has been shown to exert positive effects on HD cells (Ravikumar et al., 2004), was used as a positive control in this study and showed comparable results on cell viability.
Similarly, we found a strong tendency of reduction of cell death in STHdh cells (F Q7/Q7STHdh 2, 9 ¼ 1,569, p Q7/Q7STHdh ¼ 0,0733; F Q111/Q111STHdh 2, 10 ¼ 2,798, p Q111/Q111STHdh ¼ 0,0760) (Fig. 7B and D) as well as MEF cells (F Q7/Q7MEF 2, 9 ¼ 1,437, p Q7/Q7MEF ¼ 0,4425; F Q111/Q111MEF 2, 9 ¼ 4,958, p Q111/MEF Q111 ¼ 0,2810) (Suppl. Fig. 8B and D) upon A769662 treatment, as detected by lactate dehydrogenase (LDH) released into the culture media. Autophagy induction by rapamycin treatment showed similar results.
Taken together, these findings suggest a direct link between autophagy induction by activation of AMPKa, and improvement of cell viability.

3.7. Autophagy induction through A769662 or PRKAA1 overexpression decreases mHTT aggregates

It is well established that induction of autophagy reduces the amount of aggregated mHTT (Ravikumar et al., 2002). To investigate this aspect, we transfected HEK293 and STHdhQ7/Q7 cells with a HTT-exon1-eGFP or pcDNA 3.1/V5-His construct expressing either 19 or 51 Q, treated them with A769662, rapamycin or DMSO, and analysed the effect of the different treatments on aggregate formation.
Filtertrap assay of HEK293-HTT-exon1Q51 cells with a polyQdetecting antibody showed strong signals representing SDSinsoluble forms of mHTT (mHTT aggregates). After treatment with rapamycin or A769662, this signal was significantly reduced compared to DMSO-treated cells (F1,346, 2,692 ¼ 37,00, prapamycin ¼ 0,0308 pA76922 ¼ 0,0335) (Fig. 8A and C). This result was further confirmed by aggregate blotting (F2, 12 ¼ 2,923, prapamycin ¼ 0,0262 pA76922 ¼ 0,0486) (Fig. 8B and D). Moreover, immunofluorescence staining revealed high numbers of aggregates in untreated, mHTT-exon1-expressing cells, which were reduced by autophagy induction with either rapamycin or A769662 (F2, 12 ¼ 2,712, prapamycin ¼ 0,012 pA76922 ¼ 0,0247) (Fig. 8EeG).
SDS-insoluble, polyQ-containing protein aggregates were also detected in STHdh-HTT-exon1Q51 cells. In accordance with the results from HEK293 cells (Fig. 8), we further detected a clear decrease of mHTT aggregates after treatment with A769662 or rapamycin (F1,086, 3,257 ¼ 9,115, p ¼ 0,0462) (Suppl. Fig. 9A and B), suggesting enhanced autophagy-related degradation. Immunofluorescence staining confirmed these results. STHdh-HTTexon1Q51 cells showed smaller aggregates than HEK293-HTTexon1Q51 cells, but these were again decreased in number after autophagy induction (F2, 12 ¼ 10,02, prapamycin ¼ 0,049 pA76922 ¼ 0,0001) (Suppl. Fig. 9CeE).
To further investigate the effect of AMPKa activity on mHTT aggregates, we co-transfected the cells with the HTT-exon1-eGFP construct and with PRKAA1 or the corresponding empty vector (pcDNA). PRKAA1 overexpression resulted in a significant decrease of SDS-insoluble mHTT aggregates in the filtertrap assay (p ¼ 0,0154) (Fig. 9A and C) and aggregate blot (F1, 8 ¼ 18,36, p ¼ 0,0004) (Fig. 9B and D), and a significant reduction in aggregate load in HEK293 cells co-expressing mHTT and compared to cells expressing only mHTT (F1, 8 ¼ 44,38, p ¼< 0,0001) (Fig. 9E and F) in immunofluorescence staining. Similar results were obtained for STHdh cells (Suppl. Fig.10AeC) suggesting an involvement of AMPK kinase activity in the autophagy-mediated degradation of mHTT aggregates.
Taken together, these data suggest an important role of autophagy in aggregate removal and a successful induction of autophagy and mHTT aggregate degradation by activation of AMPK.

4. Discussion

Autophagy and the mTOR pathway have been repeatedly demonstrated to be involved in the HD pathogenesis, and autophagy induction was accompanied by the reduction of mHTT aggregation (Ravikumar et al., 2002, 2004). As part of the mTORC1 complex, the mTOR protein not only holds a key function in the induction of autophagy, but is also involved in other pathways necessary for cell survival, particularly under stressing conditions [reviewed in Ref. Laplante and Sabatini, 2012]. Inhibition of mTOR induces autophagy, but simultaneously suppresses protein synthesis, lipid biosynthesis, mitochondrial biogenesis and ribosome biogenesis. Therefore, modulating autophagy through inhibition of mTOR, may not be the optimal choice for the treatment of HD. In order to induce autophagy in an mTOR-independent manner, we focused on the activation of AMPK, a master regulator of cellular energy homeostasis (Steinberg and Kemp, 2009), and analysed the effect of its activation on autophagy induction, mTOR activation, cell viability and survival, as well as mHTT aggregation.
Molecular details of AMPK-regulated autophagy induction have recently been provided by several independent studies (Kim et al., 2011; Vingtdeux et al., 2010; Lee et al., 2010). In line with this, the specific AMPK inducing compound A769662 which has not been applied in HD research so far, induced autophagy in our study. AMPK activation and autophagy enhancement by A769662 resulted in genotype-independent improvement of cell viability in STHdh and MEF cells.
The improved cell viability and reduction in mHTT aggregation due to AMPK activation via A769662 in our study are in agreement with earlier reports of improved HD pathology upon autophagy induction in HD cell and animal models (Ravikumar et al., 2004). AMPK activation by metformin (Ma et al., 2007) and resveratrol (Kumar et al., 2006) has also been shown to be beneficial in HD mouse models, as well as Alzheimer’s disease cell models (Jang and Surh, 2003). Particularly, Vingtdeux and colleagues (Vingtdeux et al., 2011) detected a correlation between improvements of the Alzheimer disease phenotype and AMPK-mediated autophagy, which was also shown by Wong and Wu for HD (Wong et al., 2015; Wu et al., 2013). In parallel with our study, another group of researchers just recently obtained data suggesting that AMPK activation by genetic and pharmacological means (metformin) is protective in C. elegans, mouse striatal cell and mouse models of HD (Vazquez-Manrique et al., 2016 ) as we observed with A769662 in our study. While this in vivo study is particularly convincing because of the use of three different HD models and confirms previous studies that aimed at targeting AMPK pharmacologically (Ma et al., 2007; Kumar et al., 2006), none of these studies demonstrate that an mTOR-independent autophagy induction is a major mechanism for the neuroprotective effects of AMPK activation as clearly indicated by our results. Collectively, the results in the studies strongly emphasize AMPK and its activation as a promising therapeutic target and approach.
In contrast to the reports on beneficial effects of AMPK induction, Ju and colleagues have reported a harmful effect of AMPK activation by 5-Aminoimidazole-4-carboxamide ribonucleotide (AICAR) in HD cell and mouse models, due to a translocation of activated AMPKa1 to the nucleus, leading to increased brain atrophy and mHTT aggregate formation (Ju et al., 2011). However, AICAR seems to act differently from other AMPK inducers. Activation of AMPK has been shown to stimulate autophagy, but AMPK activation by AICAR has been demonstrated to suppress autophagy in hepatocytes (Samari and Seglen,1998; Samari et al., 2005; Meley et al., 2006) and did not affect autophagy in myoblasts (Sato et al., 2014). Additionally, AMPK activation seems to act variable in different cell types. For example, AICAR treatment inhibited autophagy in hepatocytes (Samari and Seglen,1998; Samari et al., 2005; Meley et al., 2006) but induced autophagy in ARPE-19 cells (Viiri et al., 2013), while A769662 induced autophagy through induction of AMPK activity in STHdh and MEF cells but failed to activate AMPK in skeletal muscle cells (Steinberg and Kemp, 2009).
A dosage effect might also explain the differential outcomes, as we observed a decrease in LC3II formation, and thus autophagy induction, in the presence of BafA1 at higher concentrations of A769662, when establishing the optimal concentration of A769662 for autophagy induction (data not shown). Such a condition might suppress autophagy induction by triggering the translocation of AMPKa to the nucleus. The exact mechanism of autophagy induction through AMPK is not known [reviewed in Ref. Chen and Klionsky, 2011] and it is possible that overactivation of AMPK confers negative effects on cells, via an inhibitory effect on autophagy. This aspect should be considered, when AMPK is activated.
The benefit of using A769662 to activate AMPK is that it acts in an mTOR-independent way, which has previously been shown by Liu et al. (2014), and was confirmed in our study. Resveratrol analogues (RSVAs), for instance, seem to activate AMPK by lowering extracellular Ab, which leads to an induction of autophagy in an mTOR-dependent manner (Vingtdeux et al., 2011). Compound C has also been shown to induce autophagy by inhibiting mTOR (Vucicevic et al., 2011) as well as neferine (Wong et al., 2015) and onjisaponin B (Wu et al., 2013). In contrast, the drug A769662 seems to act differently. It has been shown in a previous study that the activation of AMPK by A769662 in glioma cells occurs independently from mTOR and its targets (Liu et al., 2014). These somehow conflicting results reflect the knowledge about AMPK function in proliferation and autophagy induction, which is not completely understood so far [reviewed in Ref. Roach, 2011].
We demonstrate here that both, STHdhQ111/Q111 and MEFQ111/ Q111 cells, show increased phosphorylation of mTOR at Ser2448, suggesting increased kinase activity. Enhanced mTOR activity in HD has recently also been reported by others confirming our results (Pryor et al., 2014), although the conclusion was based on the finding of increased phosphorylation of p70 S6 kinase in presence of mHTT, while the phosphorylation of mTOR itself had not been assessed. However, the authors were able to expand these observations to mHTT-exon1-expressing cell models, emphasizing its dependency on the expanded CAG repeat (Pryor et al., 2014). In contrast to these findings, decreased expression and activity of mTOR was reported in another study based on an HD mouse model as well as samples from HD patients (Lee et al., 2015). The authors targeted the decreased mTOR activity by the overexpression of Rheb, resulting in an improvement of neuropathological abnormalities in the mice. Surprisingly, the activation of mTOR was found to induce autophagy, and its neuroprotective effect attributed to the increased autophagosomal activity (Lee et al., 2015). These conflicting results around the effects of mTOR stimulation and mTOR inhibition (Roscic et al., 2011; Ravikumar et al., 2004) show that the role of mTOR in autophagy in general and in the pathogenesis of HD in particular, is not understood in its entirety.
The finding of cytoprotective effects of autophagy induction was validated in our study by overexpression of a constitutively active form of AMPKa, leading to a comparable autophagy-inducing effect and improvement of cell viability, specifically in STHdhQ111/111 cells. In this context, Meley et al (Meley et al., 2006). have reported that the expression of a dominant negative form of AMPK inhibits autophagic degradation in HT-29 and HeLa cells under starvation, while overexpression of a constitutively active form of AMPK did not affect autophagy. These results suggest that AMPK activation per se, is not sufficient to induce autophagy. It has to be accompanied by an autophagy-inducing stressor such as nutrient withdrawal, or the expression of a misfolded protein (as demonstrated for mHTT in our study). The expression of mHTT in STHdh and MEF cells seems to induce cellular stress to an extent that induces autophagy in the presence of the constitutively active form of AMPKa. This idea is further supported by a recent study of Vazquez- Manrique et al. (2016) in which the down-regulation of AMPKa is attended by an impairment of cellular conditions only in the presence of a simultaneous expression of mHTT.
Aggregation of N-terminal fragments of mHTT represents a hallmark of HD (Vonsattel et al., 1998). Although the role of mHTTcontaining aggregates remains controversial [reviewed in Ref. Ross and Poirier, 2005], a decrease of these aggregates is directly linked to a successfully induced autophagic process (Ravikumar et al., 2004), and has been proven in other studies (Sarkar et al., 2005; Roscic et al., 2011). In accordance with previous results, autophagy induction by activation of AMPK through both, A769662 treatment and overexpression of a constitutively active form of AMPK, led to a significant reduction of mHTT-containing aggregates.
AMPK-activation seems also to have less severe side effects compared to mTOR inhibition by rapamycin. mTOR inhibition has adverse effects in lipid homeostasis, protein synthesis, cell proliferation and immune function (Pallet and Legendre, 2013). Therefore, drugs that can enhance the autophagic clearance of mutant or aggregate-prone proteins with minimal side effects would be highly desirable. Metformin is an approved drug for treatment of diabetes type II, showing good tolerability of the substance, adverse reactions are sporadic (Rojas and Gomes, 2013). Supplements like resveratrol might slow blood clotting and might act like oestrogen (Olas and Wachowicz, 2005; Ashby et al., 1999) and AMPK activation in brain in general is known to act appetite eenhancing (Kola, 2008). But taken together, AMPK activation seems to hold less side effects than mTOR inhibition.

5. Conclusion

Studies in cell and animal models have shown that the induction of autophagy has a therapeutic effect in HD. However, autophagy induction via its major regulator, mTOR, may accompany sideeffects due to the various intracellular functions of this protein. Therefore, we explored the activation of AMPK with the substance A769662 as an alternative means to induce autophagy, in an mTORindependent manner. We demonstrate that AMPK activation does induce autophagy and ameliorate HD pathologies in vitro, without altering mTOR activity. Thus, our study highlights AMPK as a target for the mTOR-independent enhancement of autophagy, and identifies A769662 as a potential drug candidate for the treatment of HD.

References

Ashby, J., Tinwell, H., Pennie, W., Brooks, A.N., Lefevre, P.A., Beresford, N., Sumpter, J.P., 1999. Partial and weak oestrogenicity of the red wine constituent resveratrol: consideration of its superagonist activity in MCF-7 cells and its suggested cardiovascular protective effects. J. Appl. Toxicol. 19, 39e45.
Carling, D., Sanders, M.J., Woods, A., 2008. The regulation of AMP-activated protein kinase by upstream kinases. Int. J. Obes. 32, S55eS59.
Chen, Y., Klionsky, 2011. The regulation of autophagy e unanswered questions. J. Cell Sci. 124, 161e170.
Ciechanover, A., 2005. Proteolysis: from the lysosome to ubiquitin and the proteasome. Nat. Rev. Mol. Cell Biol. 6, 79e87.
Codogno, P., Mehrpour, M., Proikas-Cezanne, T., 2011. Canonical and non-canonical autophagy: variations on a common theme of self-eating? Nat. Rev. Mol. Cell Biol. 13, 7e12.
Dubbelhuis, P.F., Meijer, A.J., 2002. Hepatic amino acid-dependent signaling is under the control of AMP-dependenT protein kinase. FEBS Lett. 521, 39e42.
Dunn Jr., W.A., 1994. Autophagy and related mechanisms of lysosome-mediated protein degradation. Trends Cell Biol. 4, 139e143.
Egan, D., Kim, J., Shaw, R.J., Guan, K.-L., 2011. The autophagy initiating kinase ULK1 is regulated via opposing phosphorylation by AMPKa and mTOR. Autophagy 7, 643e644.
Gines, S., Ivanova, E., Seong, I.-S., Saura, C.A., MacDonald, Marcy E., 2003. Enhanced akt signaling is an early pro-survival response that reflects N-Methyl-D-aspartate receptor activation in Huntington’s disease knock-in striatal cells. J. Biol. Chem. 278, 50514e50522.
Heng, M.Y., Detloff, P.J., Paulson, H.L., Albin, R.L., 2010. Early alterations of autophagy in Huntington disease-like mice. Autophagy 6, 1206e1208.
Inoki, K., Zhu, T., Guan, K.L., 2003. TSC2 mediates cellular energy response to control cell growth and survival. Cell 115, 577e590.
Jang, J.-H., Surh, Y.-J., 2003. Protective effect of resveratrol on b-amyloid-induced oxidative PC12 cell death. Free Radic. Biol. Med. 34, 1100e1110.
Ju, T.-C., Chen, H.-M., Lin, J.-T., Chang, C.-P., Chang, W.-C., Kang, J.-J., Sun, C.-P., Tao, M.-H., Chang, C., Dickson, D.W., Chern, Y., 2011. Nuclear translocation of AMPK-a1 potentiates striatal neurodegeneration in Huntington’s disease. J. Cell Biol. 194, 209e227.
Kim, J., Kundu, M., Viollet, B., Kun-Liang Guan, K.-L., 2011. AMPK and mTOR regulate autophagy through direct phosphorylation of Ulk1 Nat. Cell Biol. 13, 132e141.
Kola, B., 2008. Role of AMP-activated protein kinase in the control of appetite. J. Neuroendocrinol. 20, 942e951.
Kumar, P., Padi, S.S., Naidu, P.S., Kumar, A., 2006. Effect of resveratrol on 3nitropropionic acid-induced biochemical and behavioural changes: possible neuroprotective mechanisms. Behav. Pharmacol. 17, 485e492.
Laplante, M., Sabatini, D.M., 2012. mTOR signaling in growth control and disease. Cell 149, 274e293.
Lee, J.W., Park, S., Takahashi, Y., Wang, H.-G., 2010. The association of AMPK with ULK1 regulates autophagy. Plos One 5. http://dx.doi.org/10.1371/ journal.pone.0015394.
Lee, J.H., Tecedor, L., Chen, Y.H., Monteys, A.M., Sowada, M.J., Thompson, L.M., Davidson, B.L., 2015. Reinstating aberrant mTORC1 activity in Huntington’s disease mice improves disease phenotypes. Neuron 85, 303e315.
Levine, B., 2005. Eating oneself and uninvited guests: autophagy-related pathways in cellular defense. Cell 120, 159e162.
Liang, X.H., Kleeman, L.K., Jiang, H.H., Gordon, G., Goldman, J.E., Berry, G., Herman, B., Levine, B., 1998. Protection against fatal Sindbis virus encephalitis by beclin, a novel Bcl-2-interacting protein. J. Virol. 72, 8586e8596.
Liu, X., Chhipa, R.R., Pooya, S., Wortman, M., Yachyshin, S., Chow, L.M.L., Kumar, A., Zhou, X., Sun, Y., Quinn, B., McPherson, C., Warnick, R.E., Kendler, A., Giri, S., Poels, J., Norga, K., Viollet, B., Grabowski, G.A., Dasgupta, B., 2014. Discrete mechanisms of mTOR and cell cycle regulation by AMPK agonists independent of AMPK. PNAS 111, E435eE444.
Ma, T.C., Buescher, J.L., Oatis, B., Funk, J.A., Nash, A.J., Carrier, R.L., Hoyt, K.R., 2007. Metformin therapy in a transgenic mouse model of Huntington’s disease. Neurosci. Lett. 411, 98e103.
Martinez-Vicente, M., Talloczy, Z., Wong, E., Tang, G., Koga, H., Kaushik, S., de Vries, R., Arias, E., Harris, S., Sulzer, D., Cuervo, A.M., 2010. Cargo recognition failure is responsible for inefficient autophagy in Huntington’s disease. Nat. Neurosci. 13, 567e576.
Mehrpour, M., Esclatine, A., Beau, I., Codogno, P., 2010. Autophagy in health and disease. 1. Regulation and significance of autophagy: an overview. Am. J. Physiol. Cell Physiol. 298, C776eC785.
Meijer, A.J., Codogno, P., 2011. Autophagy: regulation by energy sensing. Curr. Biol. 21, R227eR229.
Meley, D., Bauvy, C., Houben-Weerts, J.H.P.M., Peter, F., Dubbelhuis, P.F., Helmond, M.T.J., Codogno, P., Meijer, A.J., 2006. AMP-activated protein kinase and the regulation of autophagic proteolysis. J. Biol. Chem. 281, 34870e34879.
Olas, B., Wachowicz, B., 2005. Resveratrol, a phenolic antioxidant with effects on blood platelet functions. Platelets 16, 251e260.
Pallet, N., Legendre, C., 2013. Adverse A-769662 events associated with mTOR inhibitors. Expert Opin. Drug Saf. 12, 177e186.
Pryor, W.M., Biagioli, M., Shahani, N., Swarnkar, S., Huang, W.-C., Page, D.T., MacDonald, M.E., Subramaniam, S., 2014. Huntingtin promotes mTORC1 signaling in the pathogenesis of Huntington’s disease. Sci. Signal. 7 http:// dx.doi.org/10.1126/scisignal.2005633.
Qu, X., Yu, J., Bhagat, G., Furuya, N., Hibshoosh, H., Troxel, A., Rosen, J., Eskelinen, E.L., Mizushima, N., Ohsumi, Y., Cattoretti, G., Levine, B., 2003. Promotion of tumorigenesis by heterozygous disruption of the beclin 1 autophagy gene. J. Clin. Investig. 112, 1809e1820.
Ravikumar, B., Duden, R., Rubinsztein, D.C., 2002. Aggregate-prone proteins with polyglutamine and polyalanine expansions are degraded by autophagy. Hum. Mol. Genet. 11, 1107e1117.
Ravikumar, B., Vacher, C., Berger, Z., Davies, J.E., Luo, S., Oroz, L.G., Scaravilli, F., Easton, D.F., Duden, R., O’Kane, C.J., Rubinsztein, D.C., 2004. Inhibition of mTor induces autophagy and reduces toxicity of polyglutamine expansions in fly and mouse models of Huntington disease. Nat. Genet. 36, 585e595.
Roach, P.J., 2011. Ampk ULK1 autophagy. Mol. Cell. Biol. 31, 3082e3084.
Rojas, L.B., Gomes, M.B., 2013. Metformin: an old but still the best treatment for type 2 diabetes. Diabetol. Metab. Syndr. 5 http://dx.doi.org/10.1186/1758-59965-6.
Roscic, A., Baldo, B., Crochemore, C., Marcellin, D., Paganetti, P., 2011. Induction of autophagy with catalytic mTOR inhibitors reduces huntingtin aggregates in a neuronal cell model. J. Neurochem. 119, 398e407.
Ross, C.A., Poirier, M.A., 2005. What is protein aggregation in neurodegeneration? Nat. Rev. Mol. Cell Bio. 6, 891e898.
Rubinsztein, D.C., 2006. The roles of intracellular protein-degradation pathways in neurodegeneration. Nature 443, 780e786.
Samari, H.R., Seglen, P.O., 1998. Inhibition of hepatocytic autophagy by adenosine, aminoimidazole-4-carboxamide riboside, and N6-Mercaptopurine riboside evidence for involvement of AMP-activated protein kinase. J. Biol. Chem. 273, 23758e23763.
Samari, H.R., Møller, M.T., Holden, L., Asmyhr, T., Seglen, P.O., 2005. Stimulation of hepatocytic AMP-activated protein kinase by okadaic acid and other autophagysuppressive toxins. Biochem. J. 386, 237e244.
Sarkar, S., Floto, R.A., Berger, Z., Imarisio, S., Cordenier, A., Pasco, M., Cook, L.J., Rubinsztein, D.C., 2005. Lithium induces autophagy by inhibiting inositol monophosphatase. J. Cell Biol. 170, 1101e1111.
Sato, T., Ito, Y., Nagasawa, T., 2014. Lysine suppresses myofibrillar protein degradation by regulating the autophagic-lysosomal system through phosphorylation of Akt in C2C12 cells. Springerplus 3. http://dx.doi.org/10.1186/2193-18013-584 eCollection 2014.
Steinberg, G.R., Kemp, B.E., 2009. AMPKa in Health and disease. Physiol. Rev. 89, 1025e1078.
The Huntington’s Disease Collaborative Research Group, 1993. A novel gene containing a trinucleotide repeat that is expanded and unstable on Huntington’s disease chromosomes. Cell 72, 971e983.
Thost, A.K., Do€nnes, P., Kohlbacher, O., Proikas-Cezanne, T., 2015. Fluorescencebased imaging of autophagy progression by human WIPI protein detection. Methods 75, 69e78.
Trettel, F., Rigamonti, D., Hilditch-Maguire, P., Wheeler, V.C., Sharp, A.H., Persichetti, F., Cattaneo, E., MacDonald, M.E., 2000. Dominant phenotypes produced by the HDmutation in STHdhQ111 striatal cells. Hum. Mol. Genet. 9, 2799e2809.
Vazquez-Manrique, R.P., Farina, F., Cambon, K., Dolores Sequedo, M., Parker, A.J., Millan, J.M., Weiss, A., Deglon, N., Neri, C., 2016. AMPK activation protects from neuronal dysfunction and vulnerability across nematode, cellular and mouse models of Huntington’s disease. Hum. Mol. Genet. 25, 1043e1058.
Viiri, J., Amadio, M., Marchesi, N., Hyttinen, J.M., Kivinen, N., Sironen, R., Rilla, K., Akhtar, S., Provenzani, A., D’Agostino, V.G., Govoni, S., Pascale, A., Agostini, H., Petrovski, G., Salminen, A., Kaarniranta, K., 2013. Autophagy activation clears ELAVL1/HuR-mediated accumulation of SQSTM1/p62 during proteasomal inhibition in human retinal pigment epithelial cells. PLoS One 8, e69563. http:// dx.doi.org/10.1371/journal.pone.0069563.
Vingtdeux, V., Giliberto, L., Zhao, H., Chandakkar, P., Wu, Q., Simon, J.E., Janle, E.M., Lobo, J., Ferruzzi, M.G., Davies, P., Marambaud, P., 2010. AMP-activated protein kinase signaling activation by resveratrol modulates amyloid-beta peptide metabolism. J. Biol. Chem. 285, 9100e9113.
Vingtdeux, V., Chandakkar, P., Zhao, H., d’Abramo, C., Davies, P., Marambaud, P., 2011. Novel synthetic small-molecule activators of AMPK as enhancers of autophagy and amyloid-b peptide degradation. FASEB J. 25, 219e231.
Vonsattel, G., Paul, J., DiFiglia, M., 1998. Huntington disease. J. Neuropathol. Exp. Neurol. 57, 369e384.
Vucicevic, L., Misirkic, M., Janjetovic, K., Vilimanovich, U., Sudar, E., Isenovic, E., Prica, M., Harhaji-Trajkovic, L., Kravic-Stevovic, T., Bumbasirevic, V., Trajkovic, V., 2011. Compound C induces protective autophagy in cancer cells through AMPK inhibition-independent blockade of Akt/mTOR pathway. Autophagy 7, 40e50.
Wolburg-Buchholz, K., Mack, A.F., Steiner, E., Pfeiffer, F., Engelhardt, B., Wolburg, H., 2009. Loss of astrocyte polarity marks bloodebrain barrier impairment during experimental autoimmune encephalomyelitis. Acta Neuropathol. 118, 219e233.
Wong, V.K., Wu, A.G., Wang, J.R., Liu, L., Law, B.Y., 2015. Neferine attenuates the protein level and toxicity of mutant huntingtin in PC-12 cells via induction of autophagy. Molecules 20, 3496e3514.
Woods, A., Azzout-Marniche, D., Foretz, M., Stein, S.C., Lemarchand, P., Ferre, P., Foufelle, F., Carling, D., 2000. Characterization of the role of AMP-activated protein kinase in the regulation of glucose-activated gene expression using constitutively active and dominant negative forms of the kinase. Mol. Cell. Biol. 20, 6704e6711.
Wu, A.G., Wong, V.K., Xu, S.W., Chan, W.K., Ng, C.I., Liu, L., Law, B.Y., 2013. Onjisaponin B derived from Radix Polygalae enhances autophagy and accelerates the degradation of mutant a-synuclein and huntingtin in PC-12 cells. Int. J. Mol. Sci. 14, 22618e22641.
Xiao, B., Sanders, M.J., Underwood, E., Heath, R., Mayer, F.V., Carmena, D., Jing, C., Walker, P.A., Eccleston, J.F., Haire, L.F., Saiu, P., Howell, S.A., Aasland, R., Martin, S.R., Carling, D., Gamblin, S.J., 2011. Structure of mammalian AMPK and its regulation by ADP. Nature 472, 230e233.
Xifro, X., Anglada-Huguet, M., Ru e, L., Saavedra, A., P erez-Navarro, E., Alberch, Jordi, 2011. Increased 90-kDa ribosomal S6 kinase (Rsk) activity is protective against mutant huntingtin toxicity. Mol. Neurodegener. 74 http://dx.doi.org/10.1186/ 1750-1326-6-74.
Yuk, J.M., Yoshimori, T., Jo, E.K., 2012. Autophagy and bacterial infectious diseases.