Xinyang Tablet inhibits MLK3-mediated pyroptosis to attenuate
inflammation and cardiac dysfunction in pressure overload
Junyan Wang a,b,c,1
, Bo Deng a,b,c,1
, Jing Liu a,c
, Qing Liu a,b,c
, Yining Guo a,b,c
Zhongqi Yang a,b,c
, Chongkai Fang a,b,c
, Lu Lu a,c
, Zixin Chen a,b,c
, Shaoxiang Xian a,b,c,**,
Lingjun Wang a,b,c,***, Yusheng Huang a,b,c,*
a The First Affiliated Hospital, Guangzhou University of Chinese Medicine, Guangzhou, 510405, China b First Clinical Medical College, Guangzhou University of Chinese Medicine, Guangzhou, 510405, China c Lingnan Medical Research Center, Guangzhou University of Chinese Medicine, Guangzhou, 510405, China
ARTICLE INFO
Keywords:
Xinyang tablet
MLK3
Cardiac dysfunction
Pyroptosis
ABSTRACT
Ethnopharmacological relevance: Xinyang tablet (XYT) has been traditionally used in the treatment of cardio￾vascular diseases (CVDs). Our previous study indicated that XYT exhibited protective effects in heart failure (HF).
Aim of the study: The aim of the present study was to determine the protective effects of XYT in pressure overload
induced HF and to elucidate its underlying mechanisms of action.
Materials and methods: We analyzed XYT content using high-performance liquid chromatography (HPLC.). Mice
were subjected to transverse aortic constriction (TAC) to generate pressure overload–induced cardiac remodeling
and were then orally administered XYT or URMC-099 for 1 week after the operation. HL1 mouse cardiomyoblasts
were induced by lipopolysaccharides (LPS) to trigger pyroptosis and were then treated with XYT or URMC-099.
We used echocardiography (ECG), hematoxylin and eosin (H&E) staining, Masson’s trichrome staining and a
terminal deoxynucleotidyl transferase-mediated dUTP-biotin nick end labeling (TUNEL) assay to evaluate the
effects of XYT. Messenger ribonucleic acid (mRNA) levels of collagen metabolism biomarkers and inflammation￾related factors were detected. We determined protein levels of inflammation- and pyroptosis-related signaling
pathway members via Western blot (WB). Caspase-1 activity was measured in cell lysate using a Caspase-1
Activity Assay Kit. Subsequently, to define the candidate ingredients in XYT that regulate mixed-lineage ki￾nase-3 (MLK3), we used molecular docking (MD) to predict and evaluate binding affinity with MLK3. Finally, we
screened 24 active potential compounds that regulate MLK3 via MD.
Results: ECG, H&E staining, Masson’s trichrome staining and TUNEL assay results showed that XYT remarkably
improved heart function, amelorated myocardial fibrosis and inhibited apoptosis in vivo. Moreover, it reduced
expression of proteins or mRNAs related to collagen metabolism, including collagen type 1 (COL1), fibronectin
(FN), alpha smooth-muscle actin (α-SMA), and matrix metalloproteinases-2 and -9 (MMP-2, MMP-9). XYT also
inhibited inflammation and the induction of pyroptosis at an early stage, as well as attenuated inflammation and
pyroptosis levels in vitro.
Conclusion: Our data indicated that XYT exerted protective effects against pressure overload induced myocardial
fibrosis (MF), which might be associated with the induction of pyroptosis-mediated MLK3 signaling.
* Corresponding author. The First Affiliated Hospital, Guangdong University of Chinese Medicine, Guangzhou, 510405, China.
** Corresponding author. The First Affiliated Hospital, First Clinical Medical College, and Lingnan Medical Research Center of Guangdong University of Chinese
Medicine, Guangzhou, 510405, China.
*** Corresponding author. The First Affiliated Hospital, Guangdong University of Chinese Medicine, Guangzhou, 510405, China.
E-mail addresses: [email protected] (J. Wang), [email protected] (B. Deng), [email protected] (J. Liu), [email protected] (Q. Liu),
[email protected] (Y. Guo), [email protected] (Z. Yang), [email protected] (C. Fang), [email protected] (L. Lu), [email protected]
(Z. Chen), [email protected] (S. Xian), [email protected] (L. Wang), [email protected] (Y. Huang). 1 These authors contributed equally to this research.
Contents lists available at ScienceDirect
Journal of Ethnopharmacology
journal homepage: www.elsevier.com/locate/jethpharm
Received 22 December 2020; Received in revised form 25 February 2021; Accepted 24 March 2021
Journal of Ethnopharmacology 274 (2021) 114078
1. Introduction
Heart failure (HF) is a progressive and irreversible process charac￾terized by cardiac-pump failure and cardiac remodeling; it is the final
stage of many cardiovascular diseases (CVDs). HF is associated with high
rates of hospitalization, morbidity and mortality worldwide (Shah et al.,
2011; Yu et al., 2019). Pathological cardiac remodeling, resulting from
cardiac pressure overload, volume overload, or ischemic injury, is
considered the most crucial mechanism in the development of HF,
subsequently developing cardiac hypertrophy, cardiac apoptosis and
cardiac fibrosis (Ahmad et al., 2012; Travers et al., 2016; Zile et al.,
2019). Although current and emerging approaches to treating HF,
including neurohomonal blockade, implantable defibrillators and
advanced therapies, have improved survival rates (Dick and Epelman,
2016), patient outcomes remain suboptimal (Rhee and Lavine, 2020).
Early and/or targeted treatment might be able to delay the progression
of HF. Therefore, the development of new modalities to prevent or treat
HF is of great clinical importance.
Cell death and sterile inflammation play important roles in the
development of CVDs (Ren et al., 2020; Zheng et al., 2011). Inflamma￾tion is considered essential in initiating and driving vascular diseases
(Rudemiller and Crowley, 2017; Zheng et al., 2011). Pyroptosis is a
pro-inflammatory type of regulated cell death (RCD) characterized by
gasdermin D (GSDMD)-mediated membrane pore formation, cell
swelling and rapid lysis (Wang et al., 2020b). Assembly of
nucleotide-binding oligomerization domain, leucine rich repeat and
pyrin domain containing 3 (NLRP3) inflammasome leads to Caspase-1
dependent release of the pro-inflammatory cytokines interleukin-1β
and − 18 (IL-1β and IL-18), as well as to GSDMD-mediated pyropto￾tic-cell death (Liu et al., 2018; Swanson et al., 2019; Xue et al., 2019).
Recent studies demonstrate that the NLRP3 inflammasome is activated
in cardiomyocytes (Yao et al., 2018); NLRP3 inflammasome formation
in cardiomyocytes can potentially activate Caspase-1 and induce
pyroptosis (Silvis et al., 2020) (291438121). Accumulating evidence
suggests that inhibition of this process by pharmacological or genetic
intervention is cardioprotective under many conditions (Abbate et al.,
2020; Li and Brundel, 2020; Pinar et al., 2020). More specifically,
inhibiting the NLRP3 inflammasome could attenuate pressure over￾load–induced cardiac remodeling and the development of HF (Li et al.,
2020; Sano et al., 2018; van Hout et al., 2017). Therefore, this process is
a potential target for therapeutic approaches to preventing HF.
Mixed-lineage Kinase 3 (MLK3), a member of the
microtubule-associated protein 3 kinase (MAP3K) family and also
known as MAP3K11, has been reported to play an important role in
protecting against cardiomyocyte injury (He et al., 2016). Our previous
study found that pyroptosis induced by MLK3 signaling in car￾diomyocytes is essential in the early stage of TAC (Wang et al., 2020a).
Traditional Chinese medicine (TCM) has attracted great interest as a
treatment for HF, and has been affirmed by the Journal of the American
College of Cardiology (JACC) as a major advance (Wang et al., 2020c).
Xinyang Tablet (XYT) is an institutional preparation approved by the
Guangdong Pharmaceutical and Food Administration (No. Z20071257).
Formerly known as Baoxinkang, XYT is an empirical formula that has
been clinically used for nearly 20 years and has demonstrated curative
effects against HF (Huang et al., 2000). The ingredients of XYT are Radix
astragali (Huangqi, root of Astragalus membranaceus), Herba epimedii
(Yin yanghuo, dry ground part of barrenwort [Epimeium brevicornum]
Maxim, E. sagittatum [Sieb. et Zucc] Maxim, E. pubescens Maxim, or E.
koreanum Nakai), red ginseng (Hongshen, dry root and rhizome of Panax
ginseng C. A. Mey), motherwort (Leonuri cardiacae herba; Yimucao, dry
ground part of Leonurus japonicus Houtt.), holly (Ilex angustifolia; Mao
Dongqing, root of Ilex pubescens Hook. et Arn, a famous regional drug in
the Lingnan area), Semen lepidopteris (Ting Lizi, dry ripe seeds of spring
onion [Allium fistulosum L.] and Chinese plantain (Plantago asiatica;
Abbreviations:
α-SMA alpha smooth-muscle actin
ANP atrial natriuretic peptide
ASC2 apoptosis-associated speck-like protein containing a
Caspase activation and recruitment domain
BCA bicinchoninic acid
BNP brain natriuretic peptide
cDNA complementary deoxyribonucleic acid
COL1 collagen type 1
CTGF connective-tissue growth factor
CVD cardiovascular disease
CXCL C-X-C motif chemokine
ECG echocardiography
ECL electrochemiluminescence
ECM extracellular matrix
EF ejection fraction
FS fractional shortening
FN fibronectin
GAPDH glyceraldehyde 3-phosphate dehydrogenase
GSDMD gasdermin D
GZUCM Guangzhou University of Chinese Medicine
H&E hematoxylin and eosin
HF heart failure
HPLC high-performance liquid chromatography
IL interleukin
LPS lipopolysaccharides
LVEDd left-ventricular end-diastolic diameter
LVESd left-ventricular end-systolic diameter
LVIDd left-ventricular internal-dimension diastole
LVIDs left-ventricular internal-dimension systole
MIP1α macrophage inflammatory protein 1α
MAP3K microtubule-associated protein 3 kinase
MCP-1 monocyte chemoattractant protein 1
MD molecular docking
MF myocardial fibrosis
MLK3 mixed-lineage kinase 3
MMP matrix metalloproteinase
mRNA messenger ribonucleic acid
MS mass spectrometry
NF-κB nuclear factor κ-light-chain-enhancer of activated B cells
NLRP3 nucleotide-binding oligomerization domain leucine rich
repeat and pyrin domain containing 3
p–NF-κB phosphorylated NF-κB
PVDF polyvinylidene difluoride
RCD regulated cell death
SDS-PAGE sodium dodecyl sulfate polyacrylamide gel
electrophoresis
TAC transverse aortic constriction
TCM traditional Chinese medicine
TOF time-of-flight
TUNEL terminal deoxynucleotidyl transferase-mediated dUTP￾biotin nick-end labeling
U-099 URMC-099
WB Western blot
XYT Xinyang Tablet
XYT-L low dose of Xinyang Tablet;
XYT-M medium dose of Xinyang Tablet
XYT-H high dose of Xinyang Tablet
J. Wang et al.
Journal of Ethnopharmacology 274 (2021) 114078
Che Qianzi, dry ripe seeds of Plantago depressa Willd.), all of which are
recorded in the Chinese Pharmacopoeia. XYT supplements Qi and warms
Yang, promoting blood circulation and diuresis. Administration of XYT
in patients with acute decompensated HF is reported to shorten duration
of hospital stay, reduce the use of vasoactive drugs, improve heart
function, reduce the recurrence rate of hospitalization, and improve
prognosis (Hui et al., 2011). In addition, XYT might improve cardiac
function in mice with heart failure by inhibiting excessive car￾diomyocytic autophagy (Lu et al., 2020). We also previously reported
that XYT can effectively improve cardiac function in mice with HF by
inhibiting MF (Junyan et al., 2020), and we observed induction of
pyroptosis in the early stage of pressure overload–induced HF. However,
the role and underlying mechanisms of XYT in pressure over￾load–induced cardiac remodeling have not yet been explored.
In this study, we triggered HF in mice via a transverse aortic
constriction (TAC) operation, and then conducted experiments to
investigate whether XYT exerted a protective effect against in the early
stage of pressure overload–induced HF. Moreover, we determined that
the activities of inflammation and pyroptosis-related signaling pathways
shed light on the underlying mechanisms associated with the effects of
XYT. Our results showed that XYT has promise as a therapeutic candi￾date for the clinical treatment of HF.
2. Methods
2.1. Animals
All animal procedures described in this study were approved by the
Animal Care and Use Committee of Guangzhou University of Chinese
Medicine (GZUCM; Guangzhou, China). We purchased C57BL/6J male
mice aged 8–10 weeks (weight 22–24g) from GZUCM and housed them
on a 12-h light/dark cycle at 22 ± 2 ◦C. TAC surgery was used to trigger
pressure overload–induced cardiac hypertrophy and HF. Mice were
randomly assigned to eight groups: sham, TAC, sham + URMC-099
(Sham + U-099), TAC + URMC-099 (TAC + U-099), low dose of XYT
(XYT-L), medium dose of XYT (XYT-M), high dose of XYT (XYT-H) and
perindopril. Sham + U-099 and TAC + U-099 mice were given intra￾peritoneal (i.p.) injections of URMC-099 (10 mg/kg, dissolved in 10%
dimethyl sulfoxide [DMSO], 40% polyethylene glycol 300 [PEG300]
and 50% saline; MedChemExpress, Shanghai, China) every 12 h starting
Table 1
Primer sequences.
Gene Forward sequence Reverse sequence Product length (bp)
GAPDH GGTTGTCTCCTGCGACTTCA TGGTCCAGGGTTTCTTACTCC 183
IL-1β TGCCACCTTTTGACAGTGATG ATACTGCCTGCCTGAAGCTC 162
IL-18 GTTTACAAGCATCCAGGCACAG GAAGGTTTGAGGCGGCTTTC 151
MCP-1 CAGGTCCCTGTCATGCTTCT GTGGGGCGTTAACTGCATCT 91
MIP1α CCATATGGAGCTGACACCCC GAGCAAAGGCTGCTGGTTTC 101
CXCL1 ACTCAAGAATGGTCGCGAGG GTGCCATCAGAGCAGTCTGT 123
CXCL2 TGCTGTCCCTCAACGGAAGA CTCTCAGACAGCGAGGCAC 94
CTGF CAAAAGAAACAAAGCACCAGGCA TTTACCAGCCCAGGGGACTAT 212
FN TGCAGTGACCAACATTGATCGC AAAAGCTCCCGGATTCCATCC 150
COLI TGGCCTTGGAGGAAACTTTG CTTGGAAACCTTGTGGACCAG 153
ANP GCTTCGGGGGTAGGATTGAC CACACCACAAGGGCTTAGGA 144
BNP CGGATCCGTCAGTCGTTTGG AAAGAGACCCAGGCAGAGTCA 100
MMP-2 AACGGTCGGGAATACAGCAG AAACAAGGCTTCATGGGGGC 123
MMP-9 CCAGCCGACTTTTGTGGTCT TGGCCTTTAGTGTCTGGCTG 212
MLK3 CGGGCAAAGTTCTGAACGAC TCCGCTCTTCTCCCTCGTTA 137
GAPDH, glyceraldehyde 3-phosphate dehydrogenase; IL-1β, interleukin-1β; IL-18, interleukin-18; MCP-1, monocyte chemoattractant protein 1; MIP1α, macrophage
inflammatory protein 1 α; CTGF, connective-tissue growth factor; CXCL1, -2, C-X-C motif chemokine 1, 2; FN, fibronectin; COL1, collagen type 1; ANP, atrial natriuretic
peptide; BNP; brain natriuretic peptide; MMP-2, -9, matrix metalloproteinase-2 and -9; MLK3, mixed-lineage kinase-3.
Table 2
Formulary identification of the chemical constituents of Xinyang Tablet as determined by HPLC analysis.
Number Name Formula Found mass tR (min) Content% Affinity (kcal/mol)
1 Hederasaponin-B C45H56O23 965.33045 17.37 0.006 − 7.5
2 Rutin C27H30O16 611.16091 9.8 0.010 − 7.4
3 Ikarisoside-F C31H36O14 633.21727 17.08 0.003 − 7.2
4 Epimedin-C C41H52O21 881.30879 14.9 0.075 − 7.1
5 Sagittatoside-B C32H38O14 647.23339 19.02 0.033 − 7.0
6 Epimedoside-A C32H38O15 663.22896 12.12 0.054 − 6.9
7 Hyperoside C21H20O12 465.10275 10.15 0.004 − 6.8
8 Epimedoside-C C26H28O11 517.17028 15.49 0.052 − 6.8
9 Ikarisoside-C C38H48O20 825.28395 11.48 0.005 − 6.6
10 Epimedoside-D C37H46O19 795.2724 11.73 0.009 − 6.6
11 Epimedin-A C39H50O20 839.29841 13.63 0.057 − 6.6
12 Ginsenoside-Rh4 C36H60O8 621.43652 17.33 0.011 − 6.5
13 Acteoside C29H36O15 625.21325 10.49 0.002 − 6.4
14 Plantaginin C21H20O11 449.10758 11.14 0.003 − 6.4
15 Icariin C33H40O15 677.24405 14.5 0.422 − 6.4
16 Epimedin-B C38H48O19 809.28754 13.87 0.107 − 6.3
17 Sagittatoside-A C33H40O15 677.24405 14.5 0.422 − 6.3
18 Ginsenoside-R2 C41H70O13 771.48947 14.66 0.001 − 6.2
19 Ginsenoside-Rg7 C42H72O14 801.49954 10.67 0.001 − 6.2
20 Ginsenoside-Rg3 C42H72O13 785.50499 19.25 0.006 − 6.2
21 Plantamajoside C29H36O16 641.20823 11.22 0.001 − 6.1
22 Apigenin C15H10O5 269.04581 22.45 0.002 − 6.1
23 Isorhamnetin C16H12O7 315.05246 17.12 0.008 − 6.1
24 Kumatakenin C17H14O6 315.08651 9.36 0.003 − 6.0
J. Wang et al.
Journal of Ethnopharmacology 274 (2021) 114078
7 days before TAC surgery. URMC-099, an inhibitor of MLK3, is
commonly used and has been reported as useful in investigating the role
of MLK3 in other diseases (Rhoo et al., 2014; Saminathan et al., 2019; Xu
et al., 2019). Sham and TAC mice received corresponding isotype i.p.
injections. XYT-L, XYT-M and XYT-H mice were respectively given 0.34,
0.68 and 1.36 g/kg XYT by gavage 7 days before TAC surgery. Peri￾ndopril mice were given 0.607 mg/kg perindopril by gavage 7 days
before TAC surgery. We collected samples after 14 consecutive days of
treatment.
2.2. Cell culture and treatment
We purchased the HL1 mouse cardiomyoblastic-cell line from Procell
Life Science & Technology Co., Ltd. (Wuhan, China) and cultured it in
minimum Eagle’s medium (MEM; GIBCO [Thermo Fisher Scientific,
Waltham, MA, USA]) supplemented with 10% fetal bovine serum (FBS;
GIBCO) and 100 U/ml penicillin +100 mg/ml streptomycin in an at￾mosphere of 95% air and 5% CO2 at 37 ◦C. Medium was replaced every 2
days, and cells were digested with 0.05% trypsin when their density
reached 80–90%. LPS (Sigma-Aldrich, St. Louis, MO, USA) was dissolved
in sterile deionized water and used at a final concentration of 0.5 μg/ml
to induce pyroptosis. URMC-099 (MedChemExpress, Shanghai, China)
was dissolved in DMSO and used at a concentration of 200 μM. XYT was
dissolved in DMSO and used at a final concentration of 30 μg/ml.
2.3. HPLC analysis
We dissolved XYT powder (0.3 g) in 8 ml methanol-water solution
(50%, v/v), mixed it evenly, ultrasonicated the mixture at 45 ◦C for 30
min, and let it rest for 5 min. The supernatant (1 ml) was centrifuged at
1000 rpm for 7 min and then passed through a 0.22 μm microporous
filter membrane. We injected aliquots of XYT solution into a Shimadzu
LC-30A HPLC system (Shimadzu, Kyoto, Japan) for analysis. Control
samples were obtained by the same process. All components were
separated on a Kromasil C18 column (1.7 μm, 2.1 × 100 mm; Sigma￾Aldrich) and a C18 guard column (Sigma-Aldrich). Column tempera￾ture was 30 ◦C and flow rate was 0.25 ml/min. The mobile phase was
composed of (A) a formic acid aqueous solution (0.1%, v/v) and (B)
acetonitrile using a gradient elution of 95%–75% A at 0–15 min, 75%–
5% A at 15–30 min, 5% A at 32 min, and 95% A at 32 min. Mass
spectrometry (MS) was performed on an AB SCIEX Triple Time-of-Flight
(TOF) 5600+ (SCIEX, Framingham, MA, USA). Ionization mode was
electrospray positive ion mode, ion source voltage was 5500 V, ion
source temperature was 500 ◦C, declustering potential (DP) was 100 V,
collision energy (CE) was 35 eV, and collision energy expansion (CES)
was 15 eV. The atomization gas was nitrogen, auxiliary gas 1 was 50 psi,
auxiliary gas 2 was 50 psi, and the gas curtain gas was 40 psi. The scan
range was 50–1000 m/z. The scanning range of the primary mass
spectrometer parent ion was 50–1000 m/z, inner dynein arm (IDA). Six
Fig. 1. The chromatographic fingerprint of XYT.
(A) Ion flow diagram of XYT in positive ion mode and blank control. (B) Ion flow diagram of XYT in negative ion mode and blank control. The chromatogram
contains 52 peaks representing chemical markers of different TCM components in XYT. Structures of these compounds that regulate MLK3 and their binding affinities
are listed in Table 1.
J. Wang et al.
Journal of Ethnopharmacology 274 (2021) 114078
peaks with response values of >100 cps were set for secondary MS with a
sub-ion scanning range of 50–1000; dynamic background deduction
(DBS) was enabled.
2.4. Chemicals and reagents
We purchased XYT (No. 20180401) and perindopril (Acertil, No.
2016837) from The First Affiliated Hospital of GZUCM. HPLC analyses
were performed to control the quality of XYT. URMC-099 was obtained
from MedChemExpress (Shanghai, China). Antibodies to glyceraldehyde
3-phosphate dehydrogenase (GAPDH; #2118), nuclear factor κ-light￾chain-enhancer of activated B cells (NF-κB) p65 (#8242), phosphory￾lated NF-κB (p–NF-κB) p65 (#4025), cleaved Caspase-1 (#89332),
GSDMD (#93709) and cleaved GSDMD (#50928) were purchased from
Cell Signaling Technology (CST; Danvers, MA, USA). MLK3 (11996-1-
AP) antibody was purchased from Proteintech (Wuhan, China). NLRP3
(ab214185), α-SMA (ab7817), apoptosis-associated speck-like protein
containing a Caspase activation and recruitment domain (ASC2;
ab47092), IL-1β (ab9722), IL-18 (ab71495), pro–Caspase-1 + p10 + p12
(ab179515), NLRP3 (ab179515), absent in melanoma 2 (AIM2;
Fig. 2. Molecular simulation depicting structural interactions between MLK3 and active components of XYT. Three-dimensional crystal structures of
candidate chemical agents in a complex with MLK3.Binding affinities between MLK3 and candidate chemicals are listed in Table 1.
J. Wang et al.
Journal of Ethnopharmacology 274 (2021) 114078
ab180665) and Rabbit anti-sheep secondary fluorescent antibodies
(ab150181) were purchased from Abcam (Cambridge, UK). Other re￾agents were purchased from other commercial sources.
2.5. Transverse aorta constriction surgery
We performed surgery to trigger TAC in mice according to estab￾lished protocols (Gao et al., 2018). Briefly, C57BL/6J male mice were
anesthetized by i.p. injection of sodium pentobarbital (50 mg/kg;
Sigma-Aldrich). We ligated the aorta between the right innominate and
left common carotid arteries using a 27-G needle and a 6-0 suture.
2.6. Echocardiography (ECG) analysis
At 1 week after TAC or sham surgery, we anesthetized mice with 1%
isoflurane (RWD Life Science Co., Guangdong, China) and performed
ECG using a Vevo 2100 Imaging System (VisualSonics Inc., Toronto, ON,
Canada). The heart was examined in the short-axis view at the papillary
muscle level, and the average left ventricular (LV) internal dimension
across was determined using M-mode images. Fractional shortening
percentage (FS%), ejection fraction percentage (EF%), left ventricular
end-diastolic diameter (LVEDd) and left-ventricular end-systolic diam￾eter (LVESd) were detected as previously reported (Wang et al., 2020a).
We analyzed the ECG images using blinding.
2.7. Histological analysis
We harvested mouse heart tissue and perfused it with cold
phosphate-bufferd saline (PBS), followed by fixation in 4% para￾formaldehyde (PFA) overnight at 4 ◦C. Next, the tissue was dehydrated
and embedded in paraffin, from which we cut 5-μm-thick sections for
hematoxylin and eosin (H&E) staining to determine heart size. Masson’s
trichrome staining was performed to visualize cardiac fibrosis. After
staining all slices were completely scanned using Caseviewer software
version 2.0 (Panoramic 250/MIDI, 3DHISTECH, Budapest, Hungary),
and all data was quantified and analyzed using Intel Integrated Perfor￾mance Primitives (IPP) software version 6.0 (Intel Corp., Santa Clara,
CA, USA).
2.8. Ribonucleic acid (RNA) extraction and reverse-transcription
polymerase chain reaction (RT-PCR)
We extracted total RNA from LV tissue of TAC and control mice using
TRIzol Reagent (Thermo Fisher) per the manufacturer’s instructions.
Total RNA was reverse transcribed to complementary deoxyribonucleic
acid (cDNA) using a PrimeScript RT Master Mix (TaKaRa, Shiga, Japan).
We performed PCR amplification using TB Green Premix Ex Taq
(TaKaRa) in different reaction volumes per the manufacturer’s in￾structions on a BioRad CFX96 Touch Real-Time PCR system (Bio-Rad
Laboratories, Hercules, CA, USA). Gene expression was analyzed using
the 2–ΔΔCt quantitative approach, with GAPDH set to 1. The specific
primers used to amplify genes, the sequences of which are listed in
Table 1, were produced by Sangon Biotech (Shanghai) Co., Ltd.
(Shanghai, China).
2.9. Western blotting (WB) analysis
Proteins were quantified via bicinchoninic acid (BCA) protein assay
(Thermo Fisher). We loaded equal amounts of protein (20–30 μg) from
LV samples or cells from culture bottles onto sodium dodecyl sulfate
polyacrylamide gel electrophoresis (SDS-PAGE) gel, separated them via
8–12% SDS-PAGE and then transferred them to 0.45-μm polyvinylidene
Fig. 3. XYT improved cardiac function in pressure overload–induced HF in mice. Cardiac function was calculated by ECG 1 week post-TAC surgery in different
groups. (A) EF%. (B) FS%. (C) LVIDd. (D) LVIDs. (E–F) mRNA expression levels of ANP and BNP as determined by RT-PCR. Messenger RNA levels were normalized to
GAPDH and are expressed as fold change of the levels determined in control mice. Data are shown as mean ± SEM; n = 6; **P < 0.01 vs. sham group; #P < 0.05, ##P
< 0.01 vs. TAC group.
J. Wang et al.
Journal of Ethnopharmacology 274 (2021) 114078
Fig. 4. Fig. 4. Xinyang Tablet alleviated cardiac fibrosis in pressure overload–induced HF in mice. (A–B) Representative images of H&E (upper row) and
Masson’s (lower row) staining; quantitative analysis of collagen/left-ventricular area (B) in pressure overload–induced HF in mice 1 week after TAC or sham
operation. (C–D) RT-PCR analysis of MMP-2 (C) and MMP-9 (D) mRNA in hearts 1 week after TAC or sham operation. Messenger RNA levels were normalized to
GAPDH and expressed as the fold change of the levels determined in control mice. (E–G) RT-PCR analysis of genes associated with cardiac fibrosis, including FN (E),
COL1 (F) and CTGF (G) mRNA. (H) WB analysis of α-SMA protein in hearts 1 week after TAC or sham operation. GAPDH served as a loading control. Data are shown
as mean ± SEM; n = 5–6; **P < 0.01 vs. sham group; ##P < 0.01 vs. TAC group.
J. Wang et al.
Journal of Ethnopharmacology 274 (2021) 114078
difluoride (PVDF) membranes (MerckMillipore, Burlington MA, USA).
After we blocked them with 5% non-fat milk in 0.1% tris-buffered saline
+ Polysorbate 20 (TBST), the membranes were probed overnight with
1:1000 GAPDH, 1:1000 MLK3, 1:1000 NF-κB p65, 1:1000 p–NF-κB p65,
1:1000 NLRP3, 1:1000 ASC2, 1:1000 IL-1β, 1:1000 IL-18, 1:1000
cleaved Caspase-1, 1:1000 GSDMD (CST; 93709), 1:1000 AIM2 and
1:500 α-SMA at 4 ◦C. Next, we washed the membranes three times (7
min/wash) and then incubated them with secondary antibody (1:5000)
for 1 h at RT. After another three washes, protein amounts were deter￾mined via electrochemiluminescence (ECL). Bands were quantified by
densitometry using ImageJ software version 1.52a (National Institutes
of Health (NIH), Bethesda, MD, USA; Laboratory for Optical and
Computational Instrumentation (LOCI), University of Wisconsin, Madi￾son, WI, USA). We used GAPDH, set to 1, as a loading control.
2.10. Terminal deoxynucleotidyl transferase-mediated dUTP-biotin nick
end labeling (TUNEL) staining
Heart samples were isolated, rinsed with PBS. After shaking the slices
dry, we covered the tissues with membrane rupture working fluid for 20
min, after which we discarded this fluid and added TUNEL dye to the
slices. Two hours later, we added 4′
,6-diamidino-2-phenylindole (DAPI)
to the slices for 5 min and allowed them to incubate in the dark. Next,
the slices were washed three times with PBS (3 min/wash), shaken dry
and sealed with anti-fluorescence quenching sealant. We used a fluo￾rescence microscope (Nikon, TXM-500C, Japan) in a darkroom for
observation and image collection.
2.11. Immunofluorescence (IF) analysis
HL1 cells were rinsed with PBS, fixed in 4% PFA for 10 min, and then
washed three times with PBS (3 min/wash). Next, we added 5% goat
serum to block the cells. Sheep anti-mouse NLRP3 primary antibody
(Abcam; ab179515; 1:100) was added to the cells, which were allowed
to incubate at room temperature (RT) for 60 min. Next, we washed the
cells three more times with PBS (3 min/wash), incubated the cells with
Rabbit anti-sheep secondary fluorescent antibodies (Abcam; ab150181;
1:1000) at RT in the dark for 60 min, and then again washed them three
times with PBS (3 min/wash). Finally, we added 50 μL DAPI solution to
the cells, incubated them for 5 min and performed three final washes
with PBS (3 min/wash). We used the fluorescence microscope (Nikon) in
the darkroom to observe and collect images.
2.12. Caspase-1 activity
We measured Caspase-1 activity in cell lysate using a Caspase-1
Activity Assay Kit (C1102; Beyotime Institute of Biotechnology,
Shanghai, China) per the manufacturer’s instructions.
2.13. Molecular simulation study
We performed molecular docking (MD) to clarify the binding
mechanism between MLK3 (PDB ID: 6AQB) and bioactive compounds.
From the Traditional Chinese Medicine Systems Pharmacology Database
(TCMSP; https://tcmspw.com/tcmsp.php), we downloaded small￾molecule compounds in mol2 format. We used AutoDock vina soft￾ware (Scripps Research, San Diego, CA, USA) to convert mol2 files into
Protein Data Bank (PDB) format, PyMOL (Schrodinger, ¨ Inc., New York,
NY, USA) and AutoDockTools to hydrotreat and decharge the proteins,
AutoDock Grid Box software (Scripps Research, San Diego, CA, USA) to
draw the box and set parameters, AutoDock Vina to dock the modified
protein and small molecules into batches, LIGPLOT software version
4.5.3 (European Bioinformatics Institute, Cambridgeshire, UK) to view
the 2D structure of the MD results, and PyMOL to draw the MD diagram.
2.14. Statistical analysis
Data are presented as mean ± standard error of the mean (SEM) of
multiple independent replicates. We analyzed the data using GraphPad
Prism software 7.0 (GraphPad Software, San Diego, CA, USA) and SPSS
version 19.0 (IBM Corp., Armonk, NY, USA). Statistical analyses were
conducted using one-way analysis of variance (ANOVA) with Tukey’s
multiple-comparison post-hoc test for multiple comparisons. P < 0.05
was considered statistically significant.
3. Results
3.1. HPLC analysis of Xinyang Tablet
We analyzed XYT contents using HPLC as described above. Based on
Fig. 5. Xinyang Tablet suppressed myocardial apoptosis. A TUNEL assay was performed to determine cell apoptosis. (A) Representative images of heart tissues
from different groups. Blue represents DAPI staining; green (with white arrows) represents apoptotic cells. Scale bar: 50 μm. (B) Quantification of percentage of
apoptotic-cell counts in hearts from different groups. Data are shown as mean ± SEM; n = 6; **P < 0.01 vs. sham group; ##P < 0.01 vs. TAC group.
J. Wang et al.
Journal of Ethnopharmacology 274 (2021) 114078
Fig. 6. Xinyang Tablet inhibited the induction of pyroptosis. (A–C) WB and RT-PCR analyses and quantification of MLK3 in mouse hearts 1 week after TAC or
sham operation. (D) WB analysis of pyroptosis-related proteins in hearts 1 week after TAC or sham operation, including GSDMD, IL-18, AIM2, ASC2, cleaved IL-1β,
cleaved Caspase-1, NLRP3, p–NF-κB p65 and MLK3. GAPDH served as a loading control. (E–L) Quantification of relative expression of pyroptosis-related proteins.
Data are shown as mean ± SEM; n = 3; **P < 0.01 vs. sham group; ##P < 0.01 vs. TAC group.
J. Wang et al.
Journal of Ethnopharmacology 274 (2021) 114078
our investigation of the literature, seven kinds of Chinese herbs were
found to be included: Radix astragali (Huangqi), barrenwort (Herba
epimedii; Yin yanghuo), red ginseng (Hongshen), motherwort (Leonuri
cardiacae herba; Yi Mucao), holly (Ilex angustifolia; Mao Dongqing),
Semen lepidopteris (Ting Lizi) and Chinese plantain (Plantago asiatica;
Che Qianzi). Active components in the database were matched to those
in XYT using high-resolution TOF-MS. In our qualitative analysis, we
detected a total of 52 active TCM components in the XYT prescription in
both positive- and negative-ion modes. Table 2 and Figs. 1 and 2 list or
arrange these components by order of MS response intensity.
3.2. Xinyang Tablet attenuated pressure overload–induced cardiac
dysfunction
To investigate the effects of XYT on pressure overload–induced car￾diac dysfunction, we performed TAC surgery on mice and evaluated
their subsequent cardiac systolic and diastolic function via ECG. As
shown in Fig. 3, TAC mice showed a marked decline in cardiac function
compared with sham group mice, as indicated by left-ventricular ejec￾tion fraction (LVEF), left-ventricular fractional shortening (LVFS).
However, these two parameters were significantly improved in the TAC
+ XYT groups compared with the TAC group. In addition, the TAC group
showed a dramatic increase in end-diastolic left-ventricular internal
dimension (LVIDd) and end-systolic left-ventricular internal dimension
(LVIDs) compared with the sham group. By contrast, treatment with XYT
effectively reduced the TAC-induced increase in LVIDd and LVIDs. These
data indicated that XYT attenuated TAC-induced cardiac dysfunction
(Fig. 3.).
3.3. Xinyang Tablet amelorated cardiac fibrosis in response to pressure
overload￾MF is considered to play a crucial role in the pathogenesis of CVD.
Mice subjected to TAC surgery have been shown to have poor cardiac
function and marked cardiac fibrosis. In order to evaluate the effect of
XYT on cardiac fibrosis in response to pressure overload in the early
stage of HF (i.e., at 1 week), we performed Masson’s staining, WB and
quantitative PCR (qPCR) analyses. According to Masson’s staining re￾sults, the TAC group showed prominent collagen deposition in heart
sections compared with the sham group. However, treatment with XYT
signifcantly decreased the deposition of extracellular matrix (ECM) and
collagen in the myocardium (Fig. 4A and B). WB analysis showed that
α-SMA levels were signifcantly increased in hearts from TAC mice, and
XYT markedly reduced α-SMA expression (Fig. 4H and I). Results of
qPCR were consistent with those of WB, showing that both mRNA and
protein levels of α-SMA were significantly increased in hearts from the
TAC group. Moreover, we consistently observed that XYT markedly
reduced mRNA levels of fibrosis-associtated genes, including collagen
types 1a1 and 3a1 (COL1A1, COL3A1), fibronectin (FN) and connective￾tissue growth factor (CTGF; Fig. 4E–G) compared with the TAC group.
To investigate the underlying mechanisms of XYT in the prevention
of MF, we then detected expression levels of matrix metalloproteinases
(MMPs), which play important roles in collagen deposition. TAC
markedly increased levels of MMP-2 and MMP-9 mRNA (Fig. 4C and D)
compared with sham group mice; these levels were significantly atten￾uated after XYT administration. Taken together, these results indicated
that XYT treatment could amelorate cardiac fibrosis induced by pressure
overload in the early stage of HF, which may be attributable to reduction
of collagen degradation via regulating the expression of MMP-2 and
MMP-9.
3.4. Xinyang Tablet suppressed myocardial apoptosis
Cell death is a fundamental process in cardiac pathologies; the death
of cardiomyocytes is a precursor to the cascade of hypertrophic and
fibrotic remodeling that leads to cardiomyopathy (Kar et al., 2019). To
Fig. 7. Xinyang Tablet downregulated the expression of inflammation-related genes. (A–F) RT-PCR analysis of IL-18 (A), IL-1β (B), MIP1α (C), MCP-1 (D),
CXCL1 (E) and CXCL2 (F) mRNAs in mouse hearts 1 week after TAC or sham surgery. Messenger RNA levels were normalized to GAPDH and are expressed as the fold
change of the levels determined in control mice. Data are shown as mean ± SEM; n = 5–6; **P < 0.01 vs. sham group; ##P < 0.01 vs. TAC group.
J. Wang et al.
Journal of Ethnopharmacology 274 (2021) 114078
Fig. 8. Xinyang Tablet attenuated LPS-induced injury to HL1 cells by inhibiting MLK3-mediated pyroptosis. (A–B) IF analysis and quantification of NLRP3 in
HL1 cells induced by LPS. Scale bar, 50 μm. (C) WB analysis of pyroptosis-related proteins in HL1 cells, including GSDMD, IL-18, cleaved IL-1β, cleaved Caspase-1,
NLRP3, p–NF-κB p65 and MLK3. GAPDH served as a loading control. (D–I) Quantification of relative expression of pyroptosis-related proteins. Data are shown as
mean ± SEM; n = 3; *P < 0.05, **P < 0.01 vs. sham group; #P < 0.05, ##P < 0.01 vs. TAC group. (J–L) RT-PCR analysis of MLK3 (J), ANP (K) and BNP (L) mRNAs in
HL1 cells. Messenger RNA levels were normalized to GAPDH and are expressed as the fold change of the levels determined in control mice. Data are shown as mean
± SEM; n = 5–6; **P < 0.01 vs. sham group; ##P < 0.01 vs. TAC group. (M) Fold change of Caspase-1 activity in HL1 cells. Mean ± SEM; n = 3; **P < 0.01 vs.
control; ##P < 0.01 vs. LPS.
J. Wang et al.
Journal of Ethnopharmacology 274 (2021) 114078
further investigate the cardioprotective effects of XYT, we performed a
TUNEL assay to evaluate apoptotic cells in mouse hearts from the sham,
TAC and other groups. Compared with the TAC group, we observed a
remarkable reduction in TUNEL-positive cells in the myocardium of the
XYT, URMC-099 and perindopril group (Fig. 5). This demonstrates that
XYT alleviated myocardial apoptosis in pressure overload–induced
cardiac dysfunction 1 week after TAC surgery.
3.5. Xingyang tablet reduced induction of pyroptosis in the early stage
We previously reported that pyroptosis was observed in the early
stage of pressure overload–induced cardiac remodeling, which was
associated with the MLK3 signaling pathway’s regulation of NF-κB and
pyroptosis (Wang et al., 2020a). In the current study, we detected
expression of MLK3 via WB and RT-PCR assays. As shown in Fig. 6A–C,
we observed a marked increase in protein and mRNA levels of MLK3 in
TAC mice but a marked decrease of these levels in mice treated with
XYT, URMC-099 or perindopril. Collectively, our data showed that XYT
and URMC-099 could downregulate MLK3 and exert pronounced pro￾tective efects on cardiac function.
To further verify the underlying mechanism by which MLK3 and its
downstream proteins regulated this process, we determined the
expression of inflammatory-response-related proteins. Compared with
TAC mice, levels of p–NF-κB were significantly decreased in XYT,
URMC-099 and perindopril-treated mice 1 week after TAC. Taken
together, these results showed that XYT downregulated the expression of
pyroptosis-related proteins, including NLRP3, ASC, IL-18, cleaved IL-1β,
cleaved Caspase-1, and GSDMD, a process that might be mediated by
MLK3 (Fig. 6DL).
3.6. Xinyang Tablet inhibited inflammation in response to pressure
overload
In the process of HF development after TAC surgery, infltration of
infammatory cells, hypertrophy of cardiac myocytes, fibroblastic pro￾liferation and fibrous scar formation in the marginal zone have been
observed in vivo (Ren et al., 2020). In order to confirm the
anti-inflammatory efects of XYT, we performed qPCR to evaluate mRNA
levels of myocardial inflammatory factors (Fig. 7). The results showed
that IL-1β and IL-18 mRNAs were highly expressed in TAC mice but not
in the XYT, URMC-099 and perindopril-treated groups. In addition,
there was no statistically significant difference among the three treat￾ment groups. Furthermore, we found that expression of macrophage
inflammatory protein 1α (MIP1α), monocyte chemoattractant protein 1
(MCP-1), and that of C-X-C motif chemokines 1 and 2 (CXCL1, CXCL2)
mRNAs were activated by TAC and were significantly decreased in the
XYT-, URMC-099- and perindopril-treated groups, respectively.
3.7. Xinyang Tablet inhibited MLK3-mediated pyroptosis to attenuate
HL1 cell injury induced by LPS
Cardiac cells are mainly composed of cardiomyocytes and cardiac
fibroblasts. Cardiomyocytic injury is usually an irreversible process. In
order to further verify that XYT played an important role in the early
stage of HF by regulating MLK3-mediated pyroptosis, we cultured LPS￾induced HL-1 cells and treated them with XYT and URMC-099. Next, we
detected NLRP3 expression via IF analysis. As shown in Fig. 8A and B,
we observed a marked increase in the level of NLRP3 in LPS-induced
cells but a marked decrease thereof in XYT- and URMC-099–treated
cells. Meanwhile, we detected the expression of proteins or mRNA
related to MLK3-mediated pyroptosis. Our data showed a marked in￾crease in protein levels of MLK3 in LPS cells but a marked decrease
thereof in cells treated with XYT or URMC-099 (Fig. 8C and D). WB
results also shown showed that XYT and URMC-099 downregulated the
expression of pyroptosis-related proteins, including p–NF-κB p65, IL-18,
cleaved IL-1β, cleaved Caspase-1 and GSDMD, which might have been
mediated by MLK3 (Fig 8C, E–I). The results also indicated that XYT and
URMC-099 could inhibit levels of MLK3, ANP and BNP mRNA and ac￾tivity of Caspase-1 in HL1 cells induced by LPS (Fig. 8J–M). Collectively,
our data showed that XYT and URMC-099 could downregulate MLK3-
mediated pyroptosis and exert pronounced protective effects against
cardiomyocytic injury.
4. Discussion
This study provided new observations in evaluating the action of XYT
in the early stage of pressure overload–induced HF in mice. We found
that treatment with XYT attenuated cardiac dysfunction in response to
pressure overload in vivo. Furthermore, XYT amelorated cardiac fibrosis,
which might be attributable to reduced collagen degradation via regu￾lation of the expression of MMP-2 and MMP-9. Moreover, XYT reduced
the induction of pyroptosis in the early stage. Subsequently, using MD,
we screened and evaluated 24 potential compounds that regulated
MLK3 from the active ingredients in our HPLC results. We found that
XYT did not exhibit obvious systemic toxicity in vivo on the basis of
weight (data not shown). We also found that XYT could inhibit MLK3-
mediated pyroptosis to attenuate LPS-induced HL1 cell injury. Taken
together, our results revealed that XYT alleviated cardiac dysfunction,
MF and cardiomyocytic injury and exerted cardioprotective effects in
the early stage of HF.
HF is a complicated syndrome in pathophysiology and manifestation,
which is attributed to the abnormalities and dysfunction of cardiac
structure and blood pumping. MF, characterized by excessive deposition
of ECM proteins (e.g., dysregulated collagen turnover, excessive diffuse
collagen accumulation), disrupts the myocardial architecture, and con￾tributes to myocardial disarray, tissue stiffness and dysfunction, which
ultimately accelerate the progression to HF (Pezel et al., 2020; Pinar
et al., 2020; Segura et al., 2014). MF is believed to be associated with a
concomitant increase in MMP activity and ECM degradation (Afratis
et al., 2018; Levick et al., 2011; Li and Feldman, 2001). The common
result is often an increase in MMPs accompanied by increased fibrosis. In
this study, we found that treatment with XYT could attentuate pressure
overload–induced MF 1 week after TAC surgery, which might be
attributable to reduced collagen degradation via downregulation of
MMP-2 and -9 expression.
Recently, accumulating evidence has shown that MLK3 plays a vital
role in regulating the development of fibrotic diseases. MLK3-deficient
mice are protected against diet-induced nonalcoholic steatohepatitis
(NASH) and liver fibrosis. Another research team also reported that
MLK3 mediates fibroblastic activation to cause pulmonary fibrosis. More
specifically, they showed that expression of MLK3 was upregulated in
human patients with cardiomyopathy (Calamaras et al., 2019). Our data
showed that MLK3 was markedly increased in TAC mice. URMC-099, a
mixed lineage kinase inhibitor, exhibits similar effects in improving
heart function and in ameliorating hypertrophy and MF before or after
TAC surgery, suggesting that MLK3 exerts a protective effect on cardiac
remodeling.
Pyroptotic-cell death or pyroptosis is characterized by Caspase-1
dependent formation of plasma membrane pores, leading to the
release of pro-inflammatory cytokines and cell lysis. Pyroptosis tightly
controls the inflammatory response by releasing pro-inflammatory
cellular contents such as IL-1β and IL-18, which consequently expand
or sustain inflammation (Liu et al., 2018; Zeng et al., 2019). Inflam￾mation is a prominent feature in the early stage of HF and is charac￾terized by increased production of pro-inflammatory cytokines,
resulting in fibroblastic activation and eventually MF (Abbadi et al.,
2018; Xiao et al., 2018). Emerging evidence indicates that non-ischemic
myocardial injury is also associated with inflammation, and it has been
demonstrated that production of inflammatory factors and inflamma￾tory cell infiltration occurs in mice subjected to TAC (Glasenapp et al.,
2020; Ren et al., 2020). It has increasingly been recognized that the
ability of NLRP3 inflammasome complexes to continuously stimulate
J. Wang et al.
Journal of Ethnopharmacology 274 (2021) 114078
the secretion of pro-inflammatory IL-1β and IL-18 from infiltrating and
resident cells within the stressed heart leads to aberrant tissue remod￾eling, ensuing fibrotic progression (Valle Raleigh et al., 2017; Xiao et al.,
2018). We previously reported that MLK3 leads to MF and cardiac
dysfunction partly through NLRP3-mediated inflammation and pyrop￾tosis in the early stage (Wang et al., 2020a). The results of this study
showed that XYT reduced the induction of pyroptosis and inhibited
inflammation in the early stage of HF.
Many studies have shown that TCM can be effective in preventing
and treating most CVDs (Leung and Xu, 2020; Long et al., 2020; Yang
et al., 2019), and its use for such purpose has been affirmed by JACC as a
major advance in HF (Wang et al., 2020c). XYT has been clinically
applied in China for the treatment of HF for 20 years, and studies have
found that it can improve heart function and shorten the duration of
hospitalization in patients with acute decompensated HF. Moreover, in
this study, XYT exerted similar effects in mice with pressure overload,
namely improving cardiac function and inhibiting cardiac fibrosis. HPLC
analysis identified seven kinds of Chinese herbs in XYT powder: Radix
astragali (Huangqi), barrenwort (Herba epimedii; Yin yanghuo), red
ginseng (Hongshen), motherwort (Leonuri cardiacae herba; Yi Mucao),
holly (Ilex angustifolia; Mao Dongqing), Semen lepidopteris (Ting Lizi) and
Chinese plantain (Plantago asiatica; Che Qianzi), which collectively
yielded a total of 52 active components.Our previous study showed that
inhibition of MLK3 can effectively improve cardiac function and prevent
MF and hypertrophy in TAC mice. To further investigate the potential
mechanism of XYT in cardiac remodeling, we performed MD to deter￾mine the interaction between MLK3 and the abovementioned 52 active
components, which mainly inhibit MLK3 activity. The results showed
that about 24 of these components, such as hederasaponin-B and rutin,
could interact with MLK3. For example, the binding energy between
hederasaponin-B and MLK3 was − 7.5 kacl/mol, indicating good binding
affinity. However, due to the lack of experimental data (cell experiments
and enzyme activity) to confirm the MD results, we need to further
investigate the effects of certain components on the regulation of MLK3
in future work.
5. Conclusions
In conclusion, the present study showed that XYT prevented pressure
overload–induced cardiac dysfunction and MF, as demonstrated by
improvements in EF% and FS%, and reduction of collagen degradation
by inhibiting the activation of MMP-2 and MMP-9, respectively. XYT
could attenuate cell injury by decreasing cell death. Notably, XYT
reduced the induction of pyroptosis in the early stage of HF. Taken
together, these findings indicate that XYT may be a potential alternative
candidate drug against cardiac dysfunction and MF in the early stage of
HF.
Author contributions
SXX, LJW and YSH conceived the idea, designed the study, partici￾pated in the analyses and revised the manuscript. JYW and BD were
mainly responsible for experiments (WB, TUNEL and qRT-PCR), study
design, and manuscript drafting. JL and YNG were responsible for H&E
and Masson experiments. QL was responsible for mouse treatments. ZQY
was responsible for the molecular-simulation study. All authors read and
approved the final manuscript.
Declaration of competing interest
The authors confirm that there are no known conflicts of interest
associated with this publication.
Acknowledgements
We thank Accdon (www.accdon.com) for its linguistic assistance and
scientific consultation during the preparation of this manuscript. This
work was supported by grants from the National Natural Science
Foundation of China (Nos.81804048, 81973776, 81973777), the Soft
Science Research Program of Guangdong Province (No.
2018B020207009), the Science and Technology Plan Foundation of
Guangzhou, and the Excellent Doctoral Dissertation Incubation Grant of
First Clinical School of Guangzhou University of Chinese Medicine (No.
YB201904).
References
Abbadi, D., Laroumanie, F., Bizou, M., Pozzo, J., Daviaud, D., Delage, C., Calise, D.,
Gaits-Iacovoni, F., Dutaur, M., Tortosa, F., Renaud-Gabardos, E., Douin-Echinard, V.,
Prats, A., Roncalli, J., Parini, A., Pizzinat, N., 2018. Local production of tenascin-C
acts as a trigger for monocyte/macrophage recruitment that provokes cardiac
dysfunction. Cardiovasc. Res. 114 (1), 123–137.
Abbate, A., Toldo, S., Marchetti, C., Kron, J., Van Tassell, B., Dinarello, C., 2020.
Interleukin-1 and the inflammasome as therapeutic targets in cardiovascular disease.
Circ. Res. 126 (9), 1260–1280.
Afratis, N., Klepfish, M., Karamanos, N., Sagi, I., 2018. The apparent competitive action
of ECM proteases and cross-linking enzymes during fibrosis: applications to drug
discovery. Adv. Drug Deliv. Rev. 129, 4–15.
Ahmad, T., Fiuzat, M., Felker, G., O’Connor, C., 2012. Novel biomarkers in chronic heart
failure. Nat. Rev. Cardiol. 9 (6), 347–359.
Calamaras, T., Baumgartner, R., Aronovitz, M., McLaughlin, A., Tam, K., Richards, D.,
Cooper, C., Li, N., Baur, W., Qiao, X., Wang, G., Davis, R., Kapur, N., Karas, R.,
Blanton, R., 2019. Mixed lineage kinase-3 prevents cardiac dysfunction and
structural remodeling with pressure overload. Am. J. Physiol. Heart Circ. Physiol.
316 (1), H145–H159.
Dick, S., Epelman, S., 2016. Chronic heart failure and inflammation: what do we really
know? Circ. Res. 119 (1), 159–176.
Gao, W., Zhou, Z., Liang, B., Huang, Y., Yang, Z., Chen, Y., Zhang, L., Yan, C., Wang,
Lu, L., Wen, Z., Xian, S., Wang, L., 2018. Inhibiting receptor of advanced glycation
end products attenuates pressure overload–induced cardiac dysfunction by
preventing excessive autophagy. Front. Physiol. 9, 1333.
Glasenapp, A., Derlin, K., Wang, Y., Bankstahl, M., Meier, M., Wollert, K., Bengel, F.,
Thackeray, J., 2020. Multimodality imaging of inflammation and ventricular
remodeling in pressure-overload heart failure. J. Nucl. Med. : Off. Publ. Soc. Nucl.
Med. 61 (4), 590–596.
He, S., Liu, S., Wu, X., Xin, M., Ding, S., Xin, D., Ouyang, H., Zhang, J., 2016. Protective
role of downregulated MLK3 in myocardial adaptation to chronic hypoxia.
J. Physiol. Biochem. 73 (3), 371–380.
Huang, Y., Xian, S., Ding, Y., Lu, L., Chen, Y., Wu, H., 2000. A clinical study of
Baoxinkang for congestive heart failure with qi-and-yang -deficiency syndrome.
Tradit. Chin. Drug Res. Clin. Pharmacol. 5, 261–265.
Hui, W., Wei, W., Rong, L., Yupeng, C., Song, W., 2011. Effects of Xinyang Tablet on
brain natriuretic peptide, hypersensitive C-reactive protein and cardiac function in
patients with acute decompensated heart failure. Tradit. Chin. Drug Res. Clin.
Pharmacol. 22, 220–223, 02.
Junyan, W., Yusheng, H., Qing, L., Zheng, Z., Bo, D., Zhaohui, W., Lingjun, W.,
Shaoxiang, X., 2020. Effects and mechanism of Xinyang Tablet on inhibiting
cardiomyocyte cell ferroptosis mediated by MLK3/JNK/p53 and preventing chronic
heart failure. China J. Tradit. Chin. Med. Pharm. 35, 2604–2607, 05.
Kar, S., Kambis, T., Mishra, P., 2019. Hydrogen sulfide-mediated regulation of cell death
signaling ameliorates adverse cardiac remodeling and diabetic cardiomyopathy. Am.
J. Physiol. Heart Circ. Physiol. 316 (6), H1237–H1252.
Leung, E., Xu, S., 2020. Traditional Chinese medicine in cardiovascular drug discovery.
Pharmacol. Res. 160, 105168.
Levick, S., Mel´endez, G., Plante, E., McLarty, J., Brower, G., Janicki, J., 2011. Cardiac
mast cells: the centrepiece in adverse myocardial remodelling. Cardiovasc. Res. 89
Li, N., Brundel, B., 2020. Inflammasomes and proteostasis novel molecular mechanisms
associated with atrial fibrillation. Circ. Res. 127 (1), 73–90.
Li, X., Zhu, Q., Wang, Q., Zhang, Q., Zheng, Y., Wang, L., Jin, Q., 2020. Protection of
sacubitril/valsartan against pathological cardiac remodeling by inhibiting the
NLRP3 inflammasome after relief of pressure overload in mice. Cardiovasc. Drugs
Ther. 34 (5), 629–640.
Li, Y., Feldman, A., 2001. Matrix metalloproteinases in the progression of heart failure:
potential therapeutic implications. Drugs 61 (9), 1239–1252.
Liu, D., Zeng, X., Li, X., Mehta, J., Wang, X., 2018. Role of NLRP3 inflammasome in the
pathogenesis of cardiovascular diseases. Basic Res. Cardiol. 113 (1), 5.
Long, W., Liao, H., Huang, X., Liu, Q., Tang, Y., Lu, L., Liu, J., Yuan, T., Ling, Y., Hong,
Duan, J., Lin, W., Xian, S., Yang, Z., 2020. Efficacy and safety of high-dose
Xueshuantong injection (lyophilised) in reducing the incidence of major adverse
cardiovascular events in patients with unstable angina: a protocol of a randomised,
parallel-arm, controlled, double-blind and multicentre clinical trial based on dual
antiplatelet therapy. BMJ open 10 (8), e038074.
Lu, Z., Jiaqi, H., Birong, L., Yaqi, H., Bingxue, L., Junyan, W., Qing, L., Jiajia, W.,
Shaoxiang, X., Lingjun, W., 2020. Effect of Xinyang tablet on improving cardiac
function in mice with heart failure by inhibiting autophagy of cardiomyocytes.
Tradit. Chin. Drug Res. Clin. Pharmacol. 31, 276–280, 03.
Pezel, T., Viallon, M., Croisille, P., Sebbag, L., Bochaton, T., Garot, J., Lima, J.,
Mewton, N., 2020. Imaging interstitial fibrosis, left ventricular remodeling, and
J. Wang et al.
Journal of Ethnopharmacology 274 (2021) 114078
function in stage A and B heart failure. JACC Cardiovasc. Imag. 05 (036) https://doi.
org/10.1016/j.jcmg.2020.05.036.
Pinar, A., Scott, T., Huuskes, B., Tapia C´
aceres, F., Kemp-Harper, B., Samuel, C., 2020.
Targeting the NLRP3 inflammasome to treat cardiovascular fibrosis. Pharmacol.
Therapeut. 209, 107511.
Ren, Z., Yu, P., Li, D., Li, Z., Liao, Y., Wang, Y., Zhou, B., Wang, L., 2020. Single-cell
reconstruction of progression trajectory reveals intervention principles in
pathological cardiac hypertrophy. Circulation 141 (21), 1704–1719.
Rhee, A., Lavine, K., 2020. New approaches to target inflammation in heart failure:
harnessing insights from studies of immune cell diversity. Annu. Rev. Physiol. 82,
Rhoo, K.H., Granger, M., Sur, J., Feng, C., Gelbard, H.A., Dewhurst, S., Polesskaya,
2014. Pharmacologic inhibition of MLK3 kinase activity blocks the in vitro migratory
capacity of breast cancer cells but has no effect on breast cancer brain metastasis in a
mouse xenograft model. PloS One 9 (9), e108487.
Rudemiller, N., Crowley, S., 2017. The role of chemokines in hypertension and
consequent target organ damage. Pharmacol. Res. 119, 404–411.
Saminathan, P., Kevadiya, B.D., Marker, D.F., Gendelman, H.E., Gorantla, S., Gelbard,
A., 2019. Broad spectrum mixed lineage kinase type 3 inhibition and HIV-1
persistence in macrophages. J. Neuroimmune Pharmacol. 14 (1), 44–51.
Sano, S., Oshima, K., Wang, Y., MacLauchlan, S., Katanasaka, Y., Sano, M., Zuriaga,
Yoshiyama, M., Goukassian, D., Cooper, M., Fuster, J., Walsh, K., 2018. Tet2-
Mediated clonal hematopoiesis accelerates heart failure through a mechanism
involving the IL-1β/NLRP3 inflammasome. J. Am. Coll. Cardiol. 71 (8), 875–886.
Segura, A., Frazier, O., Buja, L., 2014. Fibrosis and heart failure. Heart Fail. Rev. 19 (2),
173–185.
Shah, Ajay, M., Mann, Douglas, L., 2011. In search of new therapeutic targets and
strategies for heart failure: recent advances in basic science. Lancet 378 (9792),
704–712.
Silvis, M., Demkes, E., Fiolet, A., Dekker, M., Bosch, L., van Hout, G., Timmers, L., de
Kleijn, D., 2020. Immunomodulation of the NLRP3 inflammasome in atherosclerosis,
coronary artery disease, and acute myocardial infarction. J. Cardiovasc. Transl.
Resear. 14 (1), 23–24.
Swanson, K., Deng, M., Ting, J., 2019. The NLRP3 inflammasome: molecular activation
and regulation to therapeutics. Nat. Rev. Immunol. 19 (8), 477–489.
Travers, J., Kamal, F., Robbins, J., Yutzey, K., Blaxall, B., 2016. Cardiac fibrosis: the
fibroblast awakens. Circ. Res. 118 (6), 1021–1040.
Valle Raleigh, J., Mauro, A., Devarakonda, T., Marchetti, C., He, J., Kim, E., Filippone,
Das, A., Toldo, S., Abbate, A., Salloum, F., 2017. Reperfusion therapy with URMC-099
recombinant human relaxin-2 (Serelaxin) attenuates myocardial infarct size and
NLRP3 inflammasome following ischemia/reperfusion injury via eNOS-dependent
mechanism. Cardiovasc. Res. 113 (6), 609–619.
van Hout, G., Bosch, L., Ellenbroek, G., de Haan, J., van Solinge, W., Cooper, M.,
Arslan, F., de Jager, S., Robertson, A., Pasterkamp, G., Hoefer, I., 2017. The selective
NLRP3-inflammasome inhibitor MCC950 reduces infarct size and preserves cardiac
function in a pig model of myocardial infarction. Eur. Heart J. 38 (11), 828–836.
Wang, J., Deng, B., Liu, Q., Huang, Y., Chen, W., Li, J., Zhou, Z., Zhang, L., Liang, B.,
He, J., Chen, Z., Yan, C., Yang, Z., Xian, S., Wang, L., 2020a. Pyroptosis and
ferroptosis induced by mixed lineage kinase 3 (MLK3) signaling in cardiomyocytes
are essential for myocardial fibrosis in response to pressure overload. Cell Death Dis.
11 (7), 574.
Wang, Q., Wu, J., Zeng, Y., Chen, K., Wang, C., Yang, S., Sun, N., Chen, H., Duan, K.,
Zeng, G., 2020b. Pyroptosis: a pro-inflammatory type of cell death in cardiovascular
disease. Clin. Chim. Acta Int. J. Clin. Chem. 510, 62–72.
Wang, X., Meng, H., Wang, Q., Shao, M., Lu, W., Chen, X., Jiang, Y., Li, C., Wang, Y.,
Tu, P., 2020c. Baoyuan decoction ameliorates apoptosis via AT1-CARP signaling
pathway in H9C2 cells and heart failure post-acute myocardial infarction rats.
J. Ethnopharmacol. 252, 112536.
Xiao, H., Li, H., Wang, J., Zhang, J., Shen, J., An, X., Zhang, C., Wu, J., Song, Y.,
Wang, X., Yu, H., Deng, X., Li, Z., Xu, M., Lu, Z., Du, J., Gao, W., Zhang, A., Feng, Y.,
Zhang, Y., 2018. IL-18 cleavage triggers cardiac inflammation and fibrosis upon
β-adrenergic insult. Eur. Heart J. 39 (1), 60–69.
Xu, H., Cheng, M., Chi, X., Liu, X., Zhou, J., Lin, T., Yang, W., 2019. High-throughput
screening identifies mixed-lineage kinase 3 as a key host regulatory factor in zika
virus infection. J. Virol. 93 (18).
Xue, Y., Enosi Tuipulotu, D., Tan, W., Kay, C., Man, S., 2019. Emerging activators and
regulators of inflammasomes and pyroptosis. Trends Immunol. 40 (11), 1035–1052.
Yang, X., He, T., Han, S., Zhang, X., Sun, Y., Xing, Y., Shang, H., 2019. The role of
traditional Chinese medicine in the regulation of oxidative stress in treating coronary
heart disease. Oxid. Med. Cel. Longev. 3231424.
Yao, C., Veleva, T., Scott, L., Cao, S., Li, L., Chen, G., Jeyabal, P., Pan, X., Alsina, K., Abu￾Taha, I., Ghezelbash, S., Reynolds, C., Shen, Y., LeMaire, S., Schmitz, W., Müller,
El-Armouche, A., Tony Eissa, N., Beeton, C., Nattel, S., Wehrens, X., Dobrev, D.,
Li, N., 2018. Enhanced cardiomyocyte NLRP3 inflammasome signaling promotes
atrial fibrillation. Circulation 138 (20), 2227–2242.
Yu, Y., Gupta, A., Wu, C., Masoudi, F.A., Li, J., 2019. Characteristics, management, and
outcomes of patients hospitalized for heart failure in China: the China PEACE
retrospective heart failure study. J. Am. Heart Assoc. 8 (17), e012884.
Zeng, C., Wang, R., Tan, H., 2019. Role of pyroptosis in cardiovascular diseases and its
therapeutic implications. Int. J. Biol. Sci. 15 (7), 1345–1357.
Zheng, Y., Gardner, S., Clarke, M., 2011. Cell death, damage-associated molecular
patterns, and sterile inflammation in cardiovascular disease. Arterioscler. Thromb.
Vasc. Biol. 31 (12), 2781–2786.
Zile, M., O’Meara, E., Claggett, B., Prescott, M., Solomon, S., Swedberg, K., Packer,
McMurray, J., Shi, V., Lefkowitz, M., Rouleau, J., 2019. Effects of sacubitril/
valsartan on biomarkers of extracellular matrix regulation in patients with HFrEF.
J. Am. Coll. Cardiol. 73 (7), 795–806.
J. Wang et al.