D of the protein complex P-gp of DNA was separated on a 5% polyacrylamide gel. The oligonucleotide sequences of an AP-probes were identified from the human MMP-1 promoter: AP for 1-3 nt, 5 ATAAAGCATGAGTCAGACAGCCT 3, 5 GGCTGTCTGACTCATGCTTTAT 3, AP 1-600 NT, 5 ATTGTTTATGAGTAAGATATCAG 3, 5 CTGATATCTTACTCA TAAACAAT Third The sense and antisense oligomers were annealed and labeled. For a competition analysis, 100-fold molar excess of cold doppelstr Independent oligomer with the consensus AP-1 binding site, 5 CGCTTGATGAGTCAGCCGGAA 3 were added at the same time as a competitor. The oligomer, DNA-protein and DNA-antibody Body complexeswere proteins Separated on a nondenaturing polyacrylamide gel in 0.5 4% TBE . The gelswere dried and X-ray film 0th 2.11. Statistical analysis All data were presented as meansS.EM Statistical analysis using an ANOVA using SPSS 12.0K. AP value of less than 0.05 was considered statistically significant. Third Results 3.1. Rh1 inhibited invasion and migration of HepG2 cells, the cytotoxicity t initially of Rh1 Highest treated was prepared by treatment of cells with HepG2 Rh1 at various concentrations for 24 and 48 h and analysis of cells with XTT 2Htetrazolium hydroxide] assay tested. As shown in Fig. 1A, has not Rh1 incubated to a cytotoxic effect at concentrations below 100 M for 24 h. However, showed a slight Rh1 cytotoxic effect at 200 M for 48 hours. Controlled as compared with cells The vehicle alone were treated with methanol, cells were treated with Rh1 in concentrations ranging from 10 to 100 m for 24 to 48 h, showed no significant Ver Change, indicating that Rh1 nontoxic HepG2 cells at these concentrations. Based on these findings, we Rh1 at concentrations of 100 m or less in all subsequent experiments. As shown in Fig. 1B, fast continuous movement of HepG2 cells was observed in a test of the wound surface. A clear definition before the migration of HepG2 cells, caused by a confluent monolayer of cells, very allm Hlich migrate to the area of zero-free cell was observed after 24 hours. Rh1 treatment significantly reduces the migration of HepG2 cells at concentrations of 10 M in a manner dependent Ngig of time. The anti-metastatic Rh1 in HepG2 cells was performed using the matrix invasion and migration assays. HepG2 cells were transfected with the chambers of the invasion and the number of adh Pensions cells in the presence or absence of Rh1 gez Applied hlt. Use of this Adh Diffusion test cell in the matrix, we have shown that treatment with reduced Rh1 for 24 h, the invasion of HepG2 cells in a konzentrationsabh Ngigen manner. Treatment with Rh1 at concentrations of 50 and 100 Minhibited cell invasion by about 44% and 61%, respectively. The migration was significantly slower in cells incubated with a 24-hour treatment with Rh1 Rh1 at concentrations of 50 and 100 M inhibited cell migration by 71% and 76% after 48 h, respectively, compared to the I trise vehicle. These results show that Rh1 significantly inhibited the invasion and migration of highly metastatic cells HepG2. 3.2. Inhibitory effect on MMP 1 Rh1 Rh1 expression effects on the expression of MMP 1 were obtained using HepG2 cells treated with various concentrations of Rh1 and subjected to RT-PCR analysis. As shown in Fig. 3a and b, Rh1 reduced mRNA expression and Ren protects intracellular.