Fluorescence intensity is shown on a standard logarithmic scale. Human T cells were CFSE-labeled as

described in detail (Kober et al., 2008). Irradiated T cell stimulator cells (2 × 106/ml) were incubated with 0.5 μM working solution of CellTracker™ Orange CMTMR (5-and 6 (4-chloromethyl-benzoyl-amino-tetramethylrhodamine) mixed isomers for 30 min at 37 °C in a CO2 incubator. The reaction was stopped by washing once with pre-warmed medium. For double-immunoflourescence CMTMR-labeled stimulator cells (8 × 104/well) and CFSE-labeled T cells (4 × 105/well) were co-cultured in a Selleckchem Bioactive Compound Library 24-well cell culture plate in phenolred-free cell culture medium for 24 h or 48 h. To visualize the stimulator cell–T cell interaction at a higher magnification, cells were co-cultured for 24 h, fixed in 4% paraformaldehyde and washed once with medium. Subsequently, cells were analyzed by laser scanning microscopy (LSM 410, ZEISS) (Kriehuber et al., 2001). CellTrace™ CFSE and CellTracker™ Orange CMTMR were both purchased from Molecular Probes (Eugene, OR). cDNA derived from hybridoma cells producing the anti-human CD3 antibody OKT3 (ATCC, Manassas, VA) was subjected to PCR amplification using primer pairs specific for the variable regions FDA approved Drug Library cost of the heavy chain (VH-for 5′ GGAATTCGCTAGCCCAGGTCCAGCTGCAGCAGTCT 3′, VH-rev 5′ GGGGGATCCGGTGACCGTGGTGCCTTGGCCCCAGTA 3′) and light chain (VL-for 5 GGAATTCGAGCTCCCAAATTGTTCTCACCCAGTCTCCA 3′ and VL-rev

5 GGGATCCCCACCGCCCCGGTTTATTTCCAACTTTGT PJ34 HCl 3′). The resulting PCR products were digested with Nhe I plus BstE II (VH) and Sac I plus BamH I (VL) and joined via a Sac I to BstE II fragment encoding a (G4S)3-linker by ligation. Two distinct DNA-fragments were generated by employing additional PCR and ligation steps: CD5L-OKT3scFv-CD28 encoded the OKT3-single chain antibody fragment flanked by the CD5 leader sequence and a BamH I to Not I fragment encoding the transmembrane and intracellular domains of human CD28, which was amplified using the primer pair (5′ CGCGGGGGATCCCCCAAGTCCCCTATTTCCCGG 3′ and 5′ GCGCCCGCGGCCGCTTTAGGAGCGATAGGCTGCGAAGT 3′), whereas CD5L-OKT3-CD14 encoded the OKT3-single chain antibody fragment flanked by the CD5 leader peptide and the leaderless

human CD14 molecule generated by fusing a CD14 BamH I to Nhe I fragment, which was amplified using the primer pair (5′ CGCGGGGGATCCCACCACGCCAGAACCTTGTGA 3′ and 5′ CCTTGAGGCGGGAGTACGCT 3′) to the Nhe I to Not I fragment of CD14 cDNA. Both constructs were cloned into the retroviral expression vector pMMP and the integrity of the synthetic expression constructs was confirmed by DNA-sequence analysis. The nucleotide sequences encoding the surface expressed anti-CD3 antibody fragments have been submitted to GenBank: accession ns. HM208751 – CD5L-OKT3-scFv-CD28 (protein_id ADN42858); and HM208750 – CD5L-OKT3-scFv-CD14 (protein_id ADN42857). Bw5147 cells were retrovirally transduced to express the CD5L-OKT3-scFv-CD28 or the CD5L-OKT3-scFv-CD14 constructs.

1). Upon discovery, a limited amount (<1 h) of video observations (inset image, Fig. 1) were collected. Subsequent inquiry of the shipping company by NOAA revealed the container’s cargo to be 1159 steel-belted automobile tires. In January 2005, the NOAA Damage Assessment Center (DAC) assessed the prospective financial impact of the deposition and deterioration of the 15 containers lost in the MBNMS. With consideration of NOAA-DAC’s evaluation, as well as potential fines, legal fees and costs to date, etc., the shipping company paid the MBNMS reparation of $3.25 million. The Compensatory Restoration Plan implemented by the MBNMS

includes assessment and monitoring

of the deep-sea benthos NVP-LDE225 in vitro at the container site. The site was revisited for this purpose during a March 2011 research cruise as a collaborative venture between MBNMS and MBARI scientists. The aim of this cruise was to produce a detailed assessment of the diversity, abundance, and assemblages of benthic mega- and macrofauna on and around this intermodal container, seven years after its deposition in the MBNMS. Habitat heterogeneity increases biodiversity (Buhl-Mortensen et al., 2010, Levin et al., 2010 and Ramirez-Llodra et al., 2011), with natural http://www.selleckchem.com/products/crenolanib-cp-868596.html and artificial structures typically attracting high densities and a

wide variety of marine taxa; so long as structures are not made from materials acutely toxic to prospective inhabitants (Bohnsack and Sutherland, 1985, Baine, 2001 and Collins et al., 2002). Indeed, artificial reefs are frequently installed in coastal regions at depths <100 m to enhance the diversity and abundance of ecologically and commercially important marine species (Bohnsack and Sutherland, 1985 and Baine, 2001). Artificial reefs have been shown to affect biological productivity and ecological connectivity; however, the types of organisms and their Olopatadine persistence on and around a newly introduced structure depend largely on their shape, composition, and location (Bohnsack and Sutherland, 1985, Baine, 2001 and Macreadie et al., 2011). Although there is general scientific agreement that artificial reefs accumulate fish and other organisms (Bohnsack and Sutherland 1985), less is known about the effects of artificial reefs on living resource production, their ability to act as stepping-stones that facilitate the dispersal of native and non-native species, how they affect disease frequency in fish and invertebrates, toxicological impacts, their long-term structural integrity, and changes to socioeconomic conditions of adjacent coastal communities (Broughton 2012).

We have suggested that when selecting the area of interest within which EBSAs are to be identified, available biogeographic classifications should be considered. In ocean-basin scale deliberations, a broad classification such as that of Watling et al. (2013) can BIBW2992 manufacturer be used. If candidate EBSAs are to be part of a global network, then it would be advantageous to conduct the analysis within each biogeographic area to generate a suite of representative EBSAs across a large region with multiple biogeographic units. Gregr et al. (2012) summarised a number of marine habitat classification methods and schemes that operate at different spatial scales, and can be useful in

helping define the location or characteristics

of EBSAs. Our method involved a simple combination of criteria using a straight-forward procedure. We used a binary outcome for each seamount against each criterion (i.e. meets or fails the criterion) without an explicit weighting of criteria in the selection process. Taranto et al. (2012) used an Ecosystem Evaluation Framework method to examine the likelihood of a seamount constituting an EBSA as well as its level of human impact. An interesting difference in the methodology applied by Taranto et al. (2012) and ours is the weighting AG-14699 that they gave to different EBSA criteria and datasets. The presence (actual or implied) of, for example, cold-water corals, was given a weight of 3, because it was applied to three EBSA criteria (C3, C4, and C6), whereas depth had a weight of 1 as it was used only as an indicator of criterion 5. In our worked example, an individual dataset was used only to evaluate a single EBSA criterion. Whether a dataset is used across criteria matters more when relative EBSA selection is based on a scoring

system (as in Taranto et al., 2012), but not if it is a yes/no categorical situation. The separation of criteria into biological and threat categories was an important step in terms of structuring the method for future management, and the phrase “in need of protection” stated in the CBD Decision IX/20 Cediranib (AZD2171) (CBD, 2008). This division also recognises that ecosystem vulnerability can be due to natural (climate) change as well as a number of direct human-induced factors. Taranto et al. (2012) also tended to separate concepts of threat from the biological attributes of an EBSA. However, they included naturalness as a biological parameter, and then separately evaluated human impacts. The latter considered the type of fishing method or mining operation, as well as the perceived relative impact to different components of the ecosystem. The worked examples provided by Taranto et al. (2012) cover 8 seamounts for which a large amount of data are available and which enable a very thorough examination.

Then the absorbance was measured at 515 nm. The capability to scavenge the DPPH radical was calculated using the following equation: DPPH scavenging activity(%)=Acontrol−AsampleAcontrol×100,where Acontrol

was the absorbance of the reaction in the presence of water and Asample the absorbance of the reaction in the presence of the extract. The extract concentration producing 50% inhibition (EC50) was calculated from the graph of the Selleckchem NVP-BKM120 DPPH scavenging effect against the extract concentration. Gallic acid, syringic acid and pyrogallol were used as standards. The 2,2′-azino-bis(3-ethylbenzthiazoline-6-sulphonic acid (ABTS)) assay was done as previously described (Soares et al., 2009). Briefly, the stock solutions were 7.4 mmol/L ABTS + and 2.6 mmol/L potassium persulfate. The working solution was then prepared by mixing the two stock solutions in equal quantities and allowing them to react for 12 h at room temperature in the dark. this website The solution was then diluted by mixing 1 mL ABTS + solution with 60 mL methanol to obtain an absorbance of 1.1 at 734 nm. A fresh ABTS + solution was prepared for each assay. A volume of 150 μL of each extract (final concentrations from 5 to 100 μg/mL) was allowed to react with 2850 μL of the ABTS + solution (final concentration of 0.02 mmol/L) for 2 h in the dark.

Finally, the absorbance at 734 nm was measured. Distilled water was used instead of mushroom extracts as a control. The capability to scavenge the ABTS radical was calculated using PIK3C2G the following equation: ABTS scavenging activity(%)=Acontrol−AsampleAcontrol×100,where Acontrol

was the absorbance of the reaction in the presence of water and Asample the absorbance of the reaction in the presence of the extract. The extract concentration producing 50% inhibition (EC50) was calculated from the graph of the ABTS scavenging effect against the extract concentration. Gallic acid, syringic acid and pyrogallol were used as standards. The ferrous ion chelating ability of extracts was determined as described previously described (Soares et al., 2009). Briefly, a sample (0.7 mL) of each extract was diluted in 0.7 mL of distilled water and mixed with 0.175 mL of FeCl2 (0.5 mmol/L) and the absorbance (A0) was measured at 550 nm. After, the reaction was initiated by the addition of 0.175 mL ferrozine (0.5 mmol/L). The mixture was shaken vigorously for 1 min and left standing at room temperature for 20 min when the absorbance (A1) was again measured at 550 nm. The percentage of inhibition of the ferrozine–Fe2+ complex formation was calculated as follows: chelating ability(%)=A0−A1A0×100. A lower absorbance indicates higher chelating ability. The extract concentration producing 50% chelating ability (EC50) was calculated from the graph of antioxidant activity percentage against the extract concentration. Gallic acid, syringic acid and pyrogallol were used as standards.

Finally, 16 educational sessions were held to inform all MICU nurses regarding sedation-related issues within the QI project. Third, RG7420 cell line execution of the project during the 4-month QI period involved the following steps: 1 Modifying the standardized MICU admission orders to change the default activity level from “bed rest” to “as tolerated. Fourth, evaluation of the project occurred on an ongoing basis during the QI period via weekly meetings of the multidisciplinary QI project team to discuss progress, barriers, and solutions. For all patients included during

the 3-month pre-QI period18 and the 4-month QI period, data from paper and electronic medical records were abstracted, and Selleck MDX-010 relevant evaluations were completed as described in the following paragraphs. Patient baseline data including demographics, comorbidities (including the Charlson Index24), and severity of illness at ICU admission were obtained from the medical record. For included patients, the following data were collected on a daily basis while in the MICU: (1) benzodiazepine and narcotic drug doses received (converted to midazolam- and morphine-equivalent doses, respectively, using standard conversion factors25 and 26), (2) sedation

and delirium status (evaluated using the validated Richmond Agitation-Sedation Scale23 and Confusion Assessment Method for the ICU27 instruments, respectively), and (3) patient pain status (based on MICU nurses’ routine clinical assessments using a standard 0–10 scale, with a HSP90 higher number representing greater pain). The number of PM&R-related consultations and treatments occurring while each patient was in the MICU was collected. In addition, daily functional mobility activities conducted by PT and OT were recorded by the therapist using standard categories from prior related research.12 “Unexpected events” occurring during PT and OT (defined as cardiopulmonary arrest, loss

of consciousness, fall, removal of any medical device, or oxygen desaturation <85% for >3 minutes) were prospectively evaluated with each treatment. In order to evaluate any overall impact of the QI project across all MICU patients, hospital administrative data were evaluated. Specifically, the number of PT and OT consultations and treatments and the number of admissions and LOS for all patients receiving care in the MICU during the 4-month QI period and the same period in the prior year were obtained from by the Departments of PM&R and Medicine, respectively. Descriptive statistics including proportions (for binary and categorical data) and medians with interquartile range (for continuous data) were used to summarize individual patient-level data and the data collected on a daily basis during patients’ MICU stay.

However, our ability to draw conclusions beyond the learn more ecological

impacts of DFTs was limited given the seven studies we synthesized were not specifically designed to examine the economic impacts of DFTs. This highlights the need for collaborations between natural and social scientists; when addressing social science questions related to natural resource management, it is imperative that social scientists are included in the design of those studies from the beginning in order to generate accurate and appropriate social science data. Therefore, we synthesized the available data on economic costs of derelict fishing traps from some of the regions in which our seven studies took place, but were unable to complete a larger analysis of the costs AP24534 to fishery resources and

fishing communities. In terms of the economic loss to commercial fisheries, an estimated 178,874 harvestable Dungeness crab are killed each year by DFTs in the Puget Sound, equaling a monetary value over $744,000 or 4.5% of average annual harvest (Antonelis et al., 2011). Interestingly, researchers in southeastern Alaska calculated a 4.5% annual entrapment rate as a proportion of annual commercial harvest of Dungeness crab, and an annual mortality of approximately 3% of regional commercial harvest (Maselko et al., 2013). In terms of revenue lost, Havens et Farnesyltransferase al. (2011) suggest that in the Virginia portion of the Chesapeake Bay derelict traps were catching as many as 913,000 crabs every year. This could be estimated to be worth

∼$304,000, which is approximately 1% of the annual commercial blue crab landings in Virginia based on a calculated average annual commercial blue crab harvest of $28,600,568 from 2008 to 2012 (Virginia Marine Resources Commission, 2014). In addition to the loss to commercial fisheries, there is a direct cost born by fishermen to replace lost traps. The cost of traps varies, but Clark et al. (2012) determined that costs ranged between $60 and $600 for fish traps. As a conservative estimate based on the USVI fishery, if a trap costs $200 to build and approximately 8% of 6500 active traps are lost each season, this amounts to $100,000 each year. Our data are limited and it is clear we need more studies of the economic impacts, given the results of the few available estimates of economic impact suggest that the economic loss due to DFTs is measurable. Management efforts that reduce mortality associated with derelict traps could have positive impacts for commercial fisheries. It is important to note that catch in DFTs may include individuals considered unallowable catch due to harvesting guidelines. Studies in Virginia and Puget Sound found that DFTs contained harvestable and non-harvestable individuals.

It provokes inhibition of the anti-inflammatory mediators and the immune responses.1 The pathogenesis of periodontal diseases is characterized by local and systemic inflammatory response to a microbial biofilm causing destruction of periodontal ligament and alveolar bone loss.2 Amplification of this initial localized response selleck chemicals results in the release of cytokines (e.g. TNF-α) and other mediators and propagation of inflammation through the gingival tissue.3 In the US adult

population, the prevalence of asthma and periodontitis can reach 11% and 35%, respectively.4 and 5 There are several studies considering the effects of non-steroidal anti-inflammatory drugs (NSAID) as modulators of periodontal disease.6 and 7 They are supposed to reduce matrix metalloproteinases and prostaglandin production, which could be associated with reduced periodontal breakdown. On the other hand, studies concerning steroidal anti-inflammatory drugs click here are scarce.8 Cavagni et al.9 reported increased tissue destruction when evaluating the effect of systemic dexamethasone in rats. von Wowern et al.10 showed reduction in

the mandibular bone mineral content following systemic corticosteroid treatment. Studies evaluating the effects of inhaled anti-inflammatory drugs on the periodontium are scarce in the literature. Moreover, it is not clear whether a regimen of exposure of either the steroid or beta-agonist to localized action might have some direct or indirect effect on the production of cytokines. The hypothesis of the present study is that inhalation of budesonide could modulate periodontal breakdown through reduction of TNF-α. The aim of the present study was to evaluate the effect of inhaled budesonide in different concentrations on TNF-α production and on ligature-induced alveolar bone loss in Wistar rats. A randomized, blind, and controlled animal study was performed. The research protocol was approved (protocol number 2008128, Sep 24 2009) by the Ethical and Research Committee of the Federal University

of Rio Grande do Sul, Brazil. The sample size estimate was based on the variability of data from a previous study,9 which evaluated a systemic corticosteroid in a ligature-induced periodontal disease model assessed by morphometric analysis. Morin Hydrate We assumed as relevant a difference of 0.16 mm in mean bone loss between groups. Considering Type I and Type II errors of 5% and 20%, respectively, it was estimated a sample size of 9 animals per group. Forty-two male adult (60 days old) Wistar rats (mean weight of 225 g) were used in the present study. The animals remained during the experimental period at the Animal Reproduction and Experimentation Centre (CREAL), submitted to a 12-h dark/light cycle. Four to five animals were housed in each cage at a controlled temperature of around 20 °C. Standard rat chew pellets (Nuvilab®, Curitiba, Brazil) and water ad libitum were given to all animals.

7

Among cohorts in Thailand and Indonesia, the incidence density of first relapse in the 2 months after a primary attack was about 5/person-year. 8, 9 and 10 Such attack rates approximate those of Plasmodium falciparum in the highest risk zones of sub-Saharan Africa. 11 Failure to prevent relapse in vivax malaria results in very high risk of debilitating illness of deepening seriousness and opportunities for onward transmission to others. Nonetheless, most patients diagnosed with vivax malaria do not receive therapy against relapse as a consequence of the rational fear of causing serious harm with primaquine among unscreened patients with G6PD deficiency. 5 Among the many drugs Ku-0059436 order available to treat the acute attack of vivax malaria, none affect the latent hypnozoites.12 The only drug registered as safe and effective in preventing relapses is primaquine, and it has been in continuous use since 1952. At therapeutic dosing against relapse, primaquine causes a mild to severe acute check details hemolytic anemia in patients having an inborn deficiency of G6PD.13 and 14 This extraordinarily diverse and complex X-linked trait occurs most frequently where there is endemic malaria transmission, as it may confer some protection against the onset of severe and threatening malaria.15 About 400 million people are affected, with an average prevalence of G6PD deficiency in

malaria endemic nations of about 8%.16 The blind administration of primaquine to patients diagnosed with vivax malaria is often rationally considered unacceptably hazardous or reckless by providers of malaria treatment services. In impoverished rural settings, patients very often are not provided primaquine therapy as a direct consequence of a lack of access to G6PD screening. G6PD deficiency as the basis of hemolytic sensitivity to primaquine was described in 1956,17 and a variety of diagnostic tests for the disorder appeared

within a decade. One of the most widely recommended and used has been the fluorescent spot test (FST) described in 1966 by hematologist and pioneering G6PD scientist Ernest Beutler.18 It has seen several decades of practical and safe Casein kinase 1 use in the developed world, but finds almost no routine application where most patients with malaria live. The reasons include cost, specialized equipment, laboratory skills, temperature sensitivity, and a cold chain for the reagents. Any one of those pitfalls may suffice to prohibit routine use in impoverished tropical settings. The combination of them explains more than 50 years without access to G6PD screening, which in turn accounts for the lack of access to primaquine therapy against vivax malaria for almost all those patients. We consider this deceptively simple problem the likely basis of most clinical attacks of vivax malaria and attendant burdens of morbidity and mortality.

Such a high number of juveniles has never been recorded in any of the populations from other regions. Juvenile specimens were reported but never at

abundances exceeding 10% of all the individuals sampled (e.g. Ryan 1956, Rychter 1999, Roche & Torchin 2007, Fowler et al. 2013). Even though both Roche & Torchin (2007) and Fowler et al. (2013) regard juveniles as specimens with CW < 2.5 mm, their data should be taken into account, because according to López-Greco & Rodríguez (1999) and Luppi et al. (2004) acquiring maturity is a long process. Histone Demethylase inhibitor Moreover, functional, gonadal and morphometric maturities are not always synchronised and can be reached at different stages of growth. In addition, our particular method of collection, the bottom dredge, could have contributed to the large abundance of smaller individuals as this method traps small, cryptic specimens hidden among other organisms (e.g. blue mussels or macrophytes). A high abundance of smaller individuals may indicate the reproductive success of R. harrisii in the Gulf of Gdańsk, and as a consequence, explain the demographic expansion of the target population. According to Gonçalves et al. (1995), R. harrisii larvae are produced from April to September in temperate areas. In the Gulf of Gdańsk, ovigerous females of R. harrisii were found

between June and October, just like selleck chemicals the population inhabiting Finnish coastal waters ( Fowler et al. 2013). Compared to other studies in the southern Baltic Sea (i.e.

the Dead Vistula River or the Vistula Lagoon), females in the Gulf of Gdańsk appear to produce egg masses earlier and retain them later than other populations ( Turoboyski 1973, Rychter 1999, Normant et al. 2004). While the differences may result from the application of a diversity of sampling regimes (i.e. dredging instead of traps), this extended reproductive period could be due to several environmental factors. In the Gulf of Gdańsk, R. harrisii experiences much more stable sea surface temperatures as compared to the Dead Vistula River or the Vistula Rucaparib molecular weight Lagoon, which are shallower areas that undergo rapid temperature changes ( Majewski 1972, Kondracki 2002). These fast temperature changes have been shown to impact the zooplankton communities in the Dead Vistula ( Paturej & Kruk 2011). Many crab species, including R. harrisii, exhibit sexual dimorphism with males attaining larger sizes than females – this has been observed in R. harrisii populations in the Dead Vistula River and the Odra Estuary ( Normant et al. 2004, Czerniejewski 2009). However, in the Gulf of Gdańsk population and other populations inhabiting Finland (introduced) and Louisiana (native), there were no significant size differences between the sexes ( Fowler et al. 2013). The biggest male found in the Gulf of Gdańsk was smaller than the biggest males from other populations inhabiting Polish waters ( Table 2).

3 Hz) through a pair of Ag/AgCl electrodes attached to the upper region of the right ventricle. Mechanical activity was investigated by measuring developed left ventricular isovolumic systolic pressure (LVISP). To evaluate contractility the rate of rise of LVISP (dP/dt) was used because it is highly sensitive to changes in contractility ( Gleason and Braunwald, 1962). These parameters were measured

with a pressure transducer connected to an amplifier (MP 100 Biopac Systems: Inc.; CA) and recorded with a data acquisition selleck screening library system (BIOPAC MP100WSW, including a software Acqknowledge III, Goleta, CA). The isovolumic pressure derivative (dP/dt) was gotten offline by the same software (digital filter Blackman −61 dB, 25 KHz of cut frequency and sample rate of 1000/s). All measurements began 30 min after mounting to allow the beating preparation to adapt to the in vitro conditions. The coronary perfusion pressure (CPP) was continuously registered by connecting a pressure transducer (TDS 104A) to the inflow of the aortic pressure tube. Since coronary flow was kept constant (10 mL/min),

changes of the CPP were dependent on changes of coronary resistance. Protocols were performed beginning with a constant diastolic pressure of 5 mm Hg by adjusting the volume of the balloon. Ventricular function curves were obtained by measuring the left ventricular isovolumic systolic pressure (LVISP) developed while diastolic pressure was increased from 0 to 30 mm Hg in steps of 5 mm Hg. Balloon volume was kept

constant during experiments involving other protocols; selleck chemical this permitted changes medroxyprogesterone in diastolic and systolic pressures to be measured. Initially, recordings were taken under control conditions in both groups. In order to analyze inotropic response, a single dose of isoproterenol (Sigma, St Louis, MO, USA) in bolus (100 μl, 10 μM) was administered to evaluate β-adrenoceptor response. Some animals were killed at the end of hemodynamic measurements. The hearts were rapidly frozen in liquid nitrogen and kept at − 80 °C until the day of analysis. Briefly, as previously reported (Moreira et al., 2003), myosin was prepared from minced and homogenized left ventricles extracted with KCl-phosphate buffer (0.3 M KCl and 0.2 M phosphate buffer [pH 6.5](Klotz et al., 1975)). Myosin ATPase activity was assayed according to previous reports (Klotz et al., 1975 and Cappelli et al., 1989) by measuring inorganic phosphate (Pi) liberation from 1 mM ATP in the presence of 50 mM HEPES (pH 7), 0.6 M KCl, 5 mM CaCl2, or 10 mM ethylene glycol-bis (β-amino ethyl ether)-N,N,N′,N′-tetra acetic acid (EGTA) in a final volume of 200 μL. Samples were assayed in duplicate or triplicate and corrected for non-enzymatic hydrolysis by using controls assayed in the same conditions, except that the protein sample was added after the interruption of the reaction by using 200 μL of 10% trichloroacetic acid.