Of note, female index partners were advised to avoid pregnancy and all couples in the study were given access to condoms and hormonal contraception free of charge. Couples were followed prospectively for up to 2 years with an endpoint of HIV-1 seroconversion of the HIV-1-susceptible

partner. Index participant follow-up visits occurred monthly and included a urine β-human chorionic gonadotropin (HCG) test (QuickVue™; Quidel Corporation, San Diego, CA, USA) to detect pregnancy. HIV-1-seronegative partner follow-up visits occurred quarterly, and included HIV-1 antibody testing and a urine β-HCG test. Dual rapid HIV-1 antibody tests were performed with confirmatory HIV-1 enzyme immunoassay (EIA) for samples with discordant or dual positive rapid assays. HIV-1 serostatus at http://www.selleckchem.com/products/AG-014699.html enrolment for all participants and during follow-up for all HIV-1 seroconverters was confirmed buy Lapatinib in batch testing conducted at the end of the study using HIV-1 EIA (Genetic Systems™ rLAV EIA; Bio-Rad Laboratories, Hercules, CA, USA) and western blot (Genetics Systems™ HIV-1; Bio-Rad Laboratories) at the University of Washington. CD4 testing for HIV-1-infected participants was performed at screening and 6-month intervals using

standard FacsCount (BD Biosciences, San Jose, CA, USA). HIV-1 RNA levels were determined at the University of Washington using the 96-test COBAS AmpliPrep/COBAS Taqman™ HIV-1 RNA assay version 1.0 (Roche Diagnostics, Indianapolis, IN, USA). This analysis used data collected Sitaxentan from study participants enrolled in Kisumu, Kenya, one of the 14 trial sites. Participants’ HIV-1 results, CD4 cell counts, urine pregnancy test results, and demographic information were extracted from the database and were used to compare couples who did and did not become pregnant. The two populations were compared using the χ2

and Student’s t-tests using sas 9.0 for Windows (SAS Institute Inc., Cary, NC, USA) and epi info 3.4.1 (Centers for Disease Control, Atlanta, Georgia, USA). The time of HIV-1 seroconversion was calculated as a range between the date of the last negative HIV-1 test and the first positive HIV-1 test. The date of conception was calculated by adding 2 weeks to the self-reported date of the last menstrual period. The timing of seroconversion and conception were compared to determine the temporal pattern, if any, of these events. Five hundred and thirty-two couples were enrolled in the study, including 532 men and 539 women; seven (1.3%) of the 532 men were enrolled with two female partners. Men and women made up 38.3 and 61.7% of the HIV-1-infected partners, respectively. The median age of male participants was 34 years [interquartile range (IQR) 29–47 years], and that of female participants was 27 years (IQR 23–34 years). Most participants were married (95.3%) and lived with their study partner (96.4%).

Persistent HEV with detectable RNA has been observed at low frequencies in solid organ transplant populations. In HIV-infected patients,

seroprevalence rates have been found to be 2.6–9%, and in those with unexplained elevated transaminases approximately 0.05% have been found to have chronic HEV/HIV infection. However, the number of studies evaluating this in large numbers of HIV-infected patients is small, and none have selleckchem used the most sensitive serological assay for screening. Persistent HEV infection has been described in individuals with undetectable HEV IgG [7–8] and the use of anti-HEV IgG for the diagnosis of HEV infection in patients with CD4 counts below 200 cells/μL may be inappropriate. Host factors associated with HEV persistence in organ transplant recipients include lower CD4+ T cell counts and tacrolimus (as opposed to cyclosporine) therapy. A single study has revealed a higher prevalence rate in those with AIDS, compared to those with HIV infection at other stages [9]. Persistent HEV has been identified as a cause for liver cirrhosis in immunosuppressed patients [9]. In those with persistent HEV and solid organ transplants, HEV viral clearance has been obtained either (i) through the reduction of immunosuppressive therapy or (ii) following treatment. To date there http://www.selleckchem.com/products/Lapatinib-Ditosylate.html are fewer than 10 individuals with HIV infection

and detectable HEV RNA described in the literature, but one small case series would recommend initial use of ribavirin alone [10] and, if this fails to eradicate infection, the addition of or a switch to PEG-IFN [11]. 1  Aggarwal R. Clinical presentation of hepatitis E. Virus Res 2011; 161:15–22. 2  Kumar A, Beniwal M, Kar P, Sharma JB, Murthy NS. Hepatitis E in pregnancy. Int J Gynaecol Obstet 2004; 85:240–244. 3  Kumar A, Aggarwal R, Naik SR, Saraswat V, Ghoshal UC, Naik S. Hepatitis E virus is responsible for decompensation of chronic

liver disease in an endemic region. Indian J Gastroenterol 2004; 23: 59–62. 4  Dalton HR, Stableforth W, Thurairajah P et al. Autochthonous hepatitis E in Southwest England: natural history, complications and seasonal variation, and hepatitis E virus IgG seroprevalence in blood donors, the elderly and patients with chronic liver disease. Eur J Gastroenterol Hepatol 2008; 20: 784–790. 5  Mansuy JM, Bendall R, Legrand-Abravanel F et al. Hepatitis Thiamine-diphosphate kinase E virus antibodies in blood donors, France. Emerg Infect Dis 2011; 17: 2309–2312. 6  Gessoni G, Manoni F. Hepatitis E virus infection in north-east Italy: serological study in the open population and groups at risk. J Viral Hepat 1996; 3: 197–202. 7  Kaba M, Richet H, Ravaux I et al. Hepatitis E virus infection in patients infected with the human immunodeficiency virus. J Med Virol 2011; 83: 1704–1716. 8  Kenfak-Foguena A, Schöni-Affolter F, Bürgisser P et al. Hepatitis E virus seroprevalence and chronic infections in patients with HIV, Switzerland. Emerg Infect Dis 2011; 17: 1074–1078.

The M. tuberculosis DAP biosynthesis genes have been demonstrated to be essential for in vitro growth and are GS-1101 in vivo therefore attractive targets for the development of novel antitubercular drugs. “
“Environmental contamination

with pesticides is an undesired consequence of agricultural activities. Biopurification systems (BPS) comprise a novel strategy to degrade pesticides from contaminated wastewaters, consisting of a highly active biological mixture confined in a container or excavation. The design of BPS promotes microbial activity, in particular by white rot fungi (WRF). Due to their physiological features, specifically the production of highly unspecific ligninolytic enzymes and some intracellular enzymatic complexes, WRF show the ability to transform a wide range of organic pollutants. This minireview summarizes find more the potential participation of WRF in BPS. The first part presents the potential use of WRF in biodegradation of pollutants, particularly pesticides, and includes a brief description of the enzymatic systems involved in their oxidation. The second part presents an outline of BPS, focusing on the elements that influence

the participation of WRF in their operation, and includes a summary of the studies regarding the fungal-mediated degradation of pesticides in BPS biomixtures and other solid-phase systems that mimic BPS. “
“The fish pathogenic oomycete Saprolegnia parasitica causes the disease Saprolegniosis in salmonids and other freshwater fish, resulting in considerable economic losses in aquaculture. Very little Rebamipide is known about the molecular and cellular mechanisms underlying the infection process of fish pathogenic oomycetes. In order to investigate the interaction in detail, an in vitro infection assay using an Oncorhynchus mykiss

(rainbow trout) cell line (RTG-2) was developed. In a zoospore/cyst cDNA library, we identified the ORF SpHtp1, which encodes a secreted protein containing an RxLR motif. Detailed expression analysis indicated that SpHtp1 is highly expressed in zoospores/cysts from S. parasitica and in the very early stages of infection on RTG-2 cells, when compared with in vitro-grown mycelium. Moreover, the protein, SpHtp1, was found to translocate into the RTG-2 trout cells, during the interaction with S. parasitica, and also when the RTG-2 cells were treated with recombinant SpHtp1 fused to a C-terminal His-tag. These findings suggest that protein translocation could play an important role in Saprolegniosis. Oomycetes contain some of the most devastating pathogens of animals and plants, causing major economic and environmental damage in natural and cultured ecosystems (Kamoun, 2003; van West, 2006; Phillips et al., 2008). One destructive oomycete pathogen of fish is Saprolegnia parasitica.

Identification, isolation and cloning for novel genes at a reasonable pace is the main driving force behind the development of unprecedented experimental approaches (Vakhlu et al., 2008). Furthermore, 99.9% of the microbial species represented in any biotope are not culturable at the moment (Streit & Schmitz, 2004; Tringe et al., 2005), which highlights the limitation of any gene discovery protocol dependent on culturing (Vakhlu et al., 2008). Thus, the diversity of enzymes with special fundamental

functions, such as Na+/H+ antiporters that usually require purification from pure culture of a specific organism before analysis, is only partially understood at present. RAD001 solubility dmso Correspondingly, a large fraction of genes in the environment cannot be disclosed due to difficulties in enriching and isolating microorganisms in pure culture. Metagenomics, a culture-independent strategy, provides an access to valuable genetic resources of the microorganisms regardless of whether they can be cultured (Cowan et al., 2005; Guazzaroni et al., 2009). The various target genes have been screened by using a metagenomic library (Schmeisser

et al., 2007). In this study, we applied this methodology for the direct cloning of genes encoding Na+/H+ antiporters from the Dagong Ancient Brine Well by functional find more complementation of antiporter-negative mutant strain. Our results demonstrated that metagenomic DNA libraries PtdIns(3,4)P2 are also suitable for direct cloning of functional genes encoding integral membrane proteins from a brine environment. About 10 families of Na+/H+ antiporter genes have been identified in microorganisms in the past, including a single gene of nhaA, nhaB, nhaC, nhaD, nhaG, nhaP, nhaH and chA, and multiple subunits of Mrp antiporter and MnhABCDEFG system (Hunte et al., 2005; Yang et al., 2006). In these genes, only nhaH comes from the halophilic bacteria H. dabanensis D-8T and H. aidingensis AD-6T. Although the gene m-nha cloned in the current study also comes from the halophiles,

to our knowledge it was the first Na+/H+ antiporter gene directly mined by metagenomic technology from the halophiles colonizing a high-salt environment. In single subunit Na+/H+ transporter, it is shown that the negatively charged amino acid residue Asp, localized in the membrane-spanning regions, plays an important role in the binding and transporting of cations such as H+ and Na+ in several antiporter proteins (Majernik et al., 2001). Asp-133, Asp-163 and Asp-164 were proposed to be involved in binding sodium ions in NhaA from E. coli (Inoue et al., 1995). Asp-137 of Nha from H. dabanensis D-8Tand H. aidingensis AD-6T (Yang et al., 2006; Zou et al., 2008), Asp-138 of SynnhaP from Synechocystis sp., and Asp-139 of ApnhaP from A. halophytica were also believed to be necessary for Na+/H+ antiporter activity (Hamada et al., 2001; Waditee et al.

Six of the nine analyzed transformants showed the expected 0.7-kb target www.selleckchem.com/products/ldk378.html band, indicating the presence of the egfp gene in the transformants (Fig. 3). Southern hybridization analysis of the transformants 5 and 43 was carried out to analyze the mode of integration of the transforming DNA (Fig. 4). The non transformed mycelium does not show any hybridization. The transformants 5 and 43 showed a different pattern of bands. The transformant 43 showed

single bands in each digestion. For the transformant 5, several bands of various sizes were observed. These results demonstrated that the introduced sequence was integrated ectopically into the chromosomal DNA with one or more copy numbers in these transformants. Transcription of egfp in the transformants 5 and 43 was demonstrated by RT-PCR (Fig. 5). Detection of fluorescence was performed in vivo on 2 days grown transformants mycelia on microscopic slides. In Fig. 6, phase-contrast micrographs of transformants (a) and the corresponding images under UV light (b) selleck compound are shown. Nontransformed mycelium did not show any fluorescence. Scanned

images show a positive fluorescence emission with respect to untransformed control. Fluorescence emission extended to entire hyphae, especially to clamps connection. Similar phenomenon was also observed when poxc promoter-driven reporter plasmid was used for transformation (to be published elsewhere). The P. ostreatus transformants 1, 5, 2, and 43 were analyzed for intracellular fluorescence emission by measuring emission of fluorescence of intracellular protein extracts from 7-day-old mycelium in comparison with the control (nontransformed mycelium; Fig. 7). The entity of fluorescence emission was measured as difference between spectrum area recorded between 500 and 550 nm for the transformant and that of the control sample (nontransformed fungus). The expression of GFP in each of the transformants has proved stable over a 6-month period of repeated subculturing on selective media (data not shown). Difference in intracellular

fluorescence emission was revealed for different transformants that could be ascribed to the different copy numbers and loci of exogen Plasmin DNA integration within the fungal genome. Variation in GFP concentration among independent fungal transformants has been observed by other authors (Chalfie et al., 1994; Cubitt et al., 1995). Comparison of intracellular fluorescence emission by transformants growth in the presence and in the absence of copper sulfate showed that metal addition causes an increase in green fluorescence driven by the poxa1b promoter, up to fourfold (20 000 fluorescence unit per 0.05 mg of proteins). It is worth noting that an induction of transcription from a particular promoter sequence was hereby demonstrated by quantitative measurement of fluorescence emission for the first time in basidiomycetes.

coli, the basis of any host specificity of those EHEC strains may be related to the production of specific colonization factors, although such adhesins of EHEC strains have not yet been identified (Bardiau et al., 2009). The aim of this study was (1) to explore the genomic differences, using suppressive subtractive hybridization (SSH), between two EHEC strains of serogroup O26, one isolated from a young calf and the other isolated from a human with diarrhea, to identify specific sequences of the bovine strain; (2) to analyze the bovine strain-specific sequences

regarding their potential implication in adherence to epithelial cells; and (3) to study the prevalence of these strain-specific sequences in a collection of human and bovine EHEC and EPEC strains. Subtractive suppressive Sorafenib hybridization (SSH) was performed between the bovine EHEC strain

4276 of serogroup O26 isolated in Ireland from a diarrheic calf (Kerr et al., 1999) and the human EHEC strain 11368 of serogroup O26 isolated in Japan from a human suffering from diarrhea (Ogura et al., 2009). The distribution of the specific sequences was investigated in additional Ulixertinib manufacturer EHEC (n = 44) and EPEC (n = 27) strains of serogroup O26 isolated from humans (n = 27) and from cattle (n = 44). Most of the strains have been described previously (Szalo et al., 2004; Bardiau et al., 2009), and their characteristics are described in the supplemental Table S1. PFGE was performed as already described (Cobbaut et al., 2009; Ooka et al., 2009) on most of the tested strains. In brief, bacterial cells were embedded in 1.8% Certified Low Melt Agarose (Bio-Rad Laboratories, Inc., Tokyo, Japan), lysed

with a buffer containing 0.2% sodium deoxycholate, 0.5% N-lauroylsarcosine, and 0.5% Brij-58, and treated with 100 μg mL−1 proteinase K. XbaI-digested genomic DNA was separated using CHEF MAPPER (Bio-Rad Laboratories, Inc.) with 1% Pulsed Field Certified Agarose (Bio-Rad Laboratories, Inc.) at 6.0 V cm−1 for 22 h and 18 min with pulsed times ranging from 47 to 44.69 s. Size of each DNA band was estimated Florfenicol by Biogene (Vilber Lourmat, France). The banding patterns were analyzed using the Dice coefficient, with an optimization and position tolerance of 1%. Dendrograms were prepared by the unweighted-pair group method using arithmetic average algorithm (UPGMA). Genomic DNA was extracted from E. coli strain 4276 and E. coli strain 11368 using the cetyltrimethylammonium bromide procedure described by Ausubel et al. (1994). Subtractive hybridization was carried out using the PCR-Select Bacterial Genome Subtractive kit (Clontech) as recommended by the manufacturer. The bovine EHEC strain 4276 was the tester, and the human EHEC strain 11368 was the driver. The PCR products obtained were cloned into the pGEM-T Easy Vector System (Promega) and transformed into E. coli JM109.

(2007). Plants were cultivated in a growth chamber under controlled conditions (8 h at R788 mouse 22 °C/16 h at 25 °C) with a light intensity of 33 μEm−2 s−1,

watered every day. Once a week, water was replaced by a 500-fold dilution of a commercial nutrient stock solution (Hydrokani AO, HydroAgri, Nanterre, France). The experiment was duplicated in similar conditions. Soil infestation was performed by adding 1 mL of conidial suspension per well containing the expected inoculum densities. In the heat-treated soil, Fo47 was introduced alone at 1 × 103, 1 × 104, 1 × 105 microconidia mL−1 of soil or in combination with the pathogenic strain Fol8 at 1 × 103 mL−1 of soil. In the nontreated soil, Fo47 was introduced alone at the same concentrations as in the heat-treated soil. In the noninfested control, the fungal inoculum was replaced by 1 mL of distilled water. There were 24 plants per treatment. Plants were harvested 10, 20 and 30 days after soil infestation. For analysis performed 10 and 20 days after soil

infestation, sampling consisted of root systems of three plants; for analysis performed 30 days after inoculation, only one root system was taken. Roots were washed Hedgehog inhibitor with sterile-distilled water, dried, weighed and frozen at −80 °C in liquid nitrogen. Frozen roots (100 mg) were ground in liquid nitrogen and DNA was extracted and purified using DNeasy Plant Mini Kit (Qiagen GmbH, Hilden, Germany). The DNA samples were stored at 4 °C. Fo47 DNA was quantified within the root DNA by real-time PCR, as described above. The quantification was performed on each of the three replicate samples and the real-time PCR reactions were duplicated. The levels of root colonization by Fo47, expressed as number of SCAR marker copies g−1 root

tissues (fresh weight), were compared by anova followed by Newman and Keuls’ test at P=0.05. ERIC-PCR fingerprinting generated various patterns among the Fusarium strains analyzed, Buspirone HCl including multiple distinct DNA fragments ranging in size from approximately 100 to 4000 bp. The comparison of ERIC patterns revealed a 440-bp fragment specific for the strain Fo47 (Fig. 1). This fragment, called FC8, was sequenced and primers P47A (CTGGTGCTCGCAGAAATGCT) and P47B (GCATGCATCGAGCGAACAAC) were designed from the sequence of FC8 to amplify a 400-bp fragment. The primer set P47A/P47B was nonspecific for the strain Fo47, as it generated a PCR fragment for all six fungal strains tested. PCR products obtained for the six strains, including Fo47 with primers P47A and P47B, were compared. Two mismatches were found between the sequence of Fo47 and the five other sequences (Fig. 2). Two oligonucleotides including these mismatches at their 3′ ends were designed: P47C (CCTCAACTTCTGATTTAAATATGA) and P47D (GAGCGAACAACTACAATAAAAG). The expected size of the PCR product with this second primer set was 211 bp. The specificity of the P47C/P47D primer pair was tested in conventional PCR (Fig.

For each provider, a score for each scenario was computed and then totaled for all scenarios. Analyses using chi-square or Fishers’ exact tests were conducted to determine if there were differences between knowledge based on various provider characteristics including, but not limited to, provider type, provider specialty, and service branch and whether a provider recently (previous 2 months) had education in management of TD. For the scenarios ANOVA or Student’s t-test was used to evaluate differences

in the total scenario score by multiple category or dichotomous groups of provider characteristic. Statistical significance for all associations was set at the p < 0.05 level (two-tail). Analysis was performed using Stata Version 10 (StataCorp, College Station, TX, USA). These AZD1208 mw BKM120 chemical structure data were collected in an anonymous manner and obtained under a protocol exempted from IRB review as determined by the Naval Medical Research Unit No. 3, Cairo, Egypt Institutional

Review Board. A total of 117 providers responded to the survey. The majority of respondents were physicians (74%) followed by independent duty corpsmen or medics (12%) (Table 1). There was a variety of training backgrounds with operational specialties (general medical officers and flight surgeon/undersea medicine officers) making up 37% and primary care (family physicians, pediatrics, and internal medicine) accounting for 40%

of the total respondents (Table 1). All respondents report having deployed at least once while 36% were currently deployed overseas in Iraq, and the median number of prior deployments of providers completing the survey was two [interquartile range (IQR) 1–3]. The majority of respondents (77%) were correctly able to identify the definition of TD (Table 2). However, only 24% of providers thought that the most common cause of TD was due to bacterial organisms, while 30% believed it was viral in nature. Respondents also incorrectly believed that norovirus was the most common cause of watery diarrhea (31%) while only 25% thought it was ETEC. Nearly half of providers correctly thought Shigella spp. (30%) or Campylobacter spp. (14%) were the most common cause of dysentery, although roughly one third (30%) thought Adenosine triphosphate ETEC was the primary cause of dysentery. Evaluation of provider responses to scenario-based questions showed a range of responses for clinical scenarios. The five most frequent management choices for each scenario are shown in Table 3. For the scenario describing mild TD with no activity limitations, most providers (49%) chose oral rehydration therapy alone, while almost 7% felt that IV hydration was appropriate in this situation. For mild diarrhea with some limitations, the most common response (18% of providers) was IV hydration alone.

Our findings correlate with the fact that intracellular upregulation of ahpC and dps expression may be an important defense for survival against

phagocytic cells of the immune system. Although oxidative killing mechanisms of the phagocytic cells may contribute to B. fragilis oxidative stress response in vivo, the current study cannot rule out that other intracellular environmental conditions may also affect the expression of ahpC and dps. One such factor is the depletion this website of iron availability in the phagolysosome compartment. Induction of ahpC and dps expression is also affected by iron limitation in vitro (data not shown), which could account for additional regulation of B. fragilis genes following internalization by phagocytic cells. In conclusion, these results indicate that the FbFPs are suitable to be used as transcriptional fusion reporters in obligate anaerobic bacteria. There seems to be a significant potential for FbFPs in the analysis of gene expression in vivo in anaerobic environments such as the human colon as well as in extraintestinal infections when used in combination with modern in vivo imaging techniques. This work Pexidartinib in vivo was supported in part by NIH/NIAID research grants AI068659 and AI079183 to E.R.R. and grant AI40588 to C.J.S. The authors

are grateful to T. Whitehead for helpful discussions. “
“The recent boom in phage therapy and phage biocontrol requires the design of suitable cocktails of genetically different bacteriophages. The current methods for typing phages need significant quantities of purified DNA, may require a priori genetic information and are cost and time consuming. We have evaluated the randomly amplified polymorphic DNA (RAPD)-PCR technique to produce unique and reproducible band patterns from 26 different bacteriophages infecting Staphylococcus

epidermidis, Staphylococcus aureus, Lactococcus lactis, Escherichia coli, Streptococcus thermophilus, Bacillus subtilis and Lactobacillus casei bacterial strains. Initially, purified DNA and phage suspensions of seven selected Methamphetamine phages were used as a template. The conditions that were found to be optimal 8 μM of 10-mer primers, 3 μM magnesium oxalacetate and 5% dimethyl sulfoxide. The RAPD genomic fingerprints using a phage titer suspension higher than 109 PFU mL−1 were highly reproducible. Clustering by the Pearson correlation coefficient and the unweighted pair group method with arithmetic averages clustering algorithm correlated largely with genetically different phages infecting the same bacterial species, although closely related phages with a similar DNA restriction pattern were indistinguishable. The results support the use of RAPD-PCR for quick typing of phage isolates and preliminary assessment of their genetic diversity bypassing tedious DNA purification protocols and previous knowledge of their sequence.

47 Similarly, hSBA GMTs were significantly higher across serogroups 1 month after vaccination with ACWY-CRM (p < 0.01) and remained significantly higher at 12 months for all serogroups except C.47 More children vaccinated with ACWY-CRM experienced local and systemic reactions compared

with those vaccinated with MPSV4; rates of pain (32% vs 24%), erythema (16% vs 6%), and induration (14% vs 4%) were significantly higher with ACWY-CRM compared with MPSV4, respectively (p < 0.05). Most local reactions were mild or moderate, and there was no significant difference between vaccines in severe systemic reactions.47 Infants experience the highest incidence of invasive meningococcal disease Selleckchem Metformin (9.2/100,000 population)3 and the highest mortality rate (0.95/100,000 population) (1990–2002).4,16,48 In three published studies in infants and toddlers to date, ACWY-CRM has been well tolerated and has resulted in a protective immune response in this age group.37–39 In phase II studies in infants, ACWY-CRM was studied using two or three doses as well as with or without adjuvant; similar immunogenicity was observed whether or not adjuvant was present. In a randomized, open-label, controlled study in 2-month-old UK infants (n = 225) and Canadian infants (n = 196), ≥88% achieved hSBA titer ≥1 : 8 in the three-dose (2,3,4 mo) UK group.39 A second randomized phase II study evaluated 180 infants in the UK

and Canada vaccinated with ACWY-CRM at age 2 and 4 months. At age 5 months, 70% to 89% of infants had hSBA titer Immune system ≥1 : 8 for all serogroups except A (44% to 49%).38 Finally, a phase II study evaluating ACWY-CRM in ZD1839 infants and toddlers (N = 175) aged 6 and 12 months showed that after a second dose at 12 months of age, hSBA ≥1 : 8 was achieved by 83% of infants against serogroup A and by 100% of infants against serogroups C, W, and Y.37 Overall, erythema and irritability were the most common adverse events38 and most local reactions were mild or moderate.37 A study

in 1620 adolescents (aged 11–18 y) has shown that ACWY-CRM can be administered concomitantly with the tetanus-diphtheria-acellular pertussis booster (Tdap; Boostrix; GlaxoSmithKline, Research Triangle Park, NC, USA) and human papillomavirus vaccines (HPV; Gardasil; Merck and Co. Inc., Whitehouse Station, NJ, USA) without decreased immunogenicity. The only significant difference in immune response to Tdap antigens was in the ACWY-CRMTdap group, which experienced an enhanced response to the pertussis antigens. Seroconversion rates for HPV were >98% for all HPV types in each group. Concomitant administration of the HPV vaccine with ACWY-CRM and Tdap did not increase reactogenicity.49 Due to the considerable and unpredictable variation of serogroup distribution globally, routine meningococcal disease vaccination in the traveler’s home country, particularly monovalent vaccines such as MenC in the UK,50 will not ensure protection at his or her destination.