The BCA protein assay (Thermo Fisher) was used to

determi

The BCA protein assay (Thermo Fisher) was used to

determine the protein concentration of each of the cleared lysates. A 30 μg sample of each caecum or colon lysate protein was boiled for 5 min in reducing sample buffer containing DTT and resolved by SDS–PAGE, transferred to PVDF membranes and probed with the indicated antibodies. The membranes were exposed to enhanced chemifluorescence substrate (GE Healthcare, Piscataway, NJ), followed by scanning on a Typhoon Trio+ imaging system (GE Healthcare) to obtain a digital image of the probed protein. The bands were then quantified with ImageQuant software Carfilzomib (GE Healthcare). Caecum and colon snips obtained from untreated and C. difficile-infected mice were homogenized with a rotor/stator-type homogenizer while immersed in TRIzol RNA reagent (Life Technologies, Grand Island, NY). The TRIzol RNA reagent and the RNeasy Mini kit (Qiagen, Valencia, CA) were used in successive steps to isolate RNA from the caecum and colon samples, each according to its manufacturer’s instructions. An Agilent Bioanalyser (Agilent Technologies, Palo Alto, CA) and a Nanodrop instrument (Thermo Fisher) were used to determine Pembrolizumab order the quality and concentration of each RNA isolate, respectively.

Complementary DNA (cDNA) was generated from each RNA sample using the RT2 First Strand kit (Qiagen). Expression levels of the genes under study were determined by using two different sets of mouse RT2 Profiler PCR cards (Qiagen), each custom-made to contain eight replicate sets of

48 primer pairs (Table 1). Each well of the replicate sets was loaded with 5 ng of cDNA reaction product. Each card was run on a LightCycler 480 real-time PCR system (Roche). The relative RNA expression levels were inferred from the Ct values. Xbp1 splicing was assessed as previously described.[39] Briefly, the Superscript III RT-PCR kit (Life Technologies) was used to amplify both unspliced and spliced Xbp1 in RNA samples obtained at the end of the experimental period. The primers used in the assay flanked the Xbp1 intron and had the following sequences: upstream: ttgtggttgagaaccagg; downstream: tccatgggaagatgttctgg. Quantitative RT-PCR, including methods for verifying primer efficiency and specificity, were performed as previously described.[40] The Ct value for each gene Org 27569 of each sample was normalized against the geometric mean of the Gapdh and Hprt for that sample.[41] For the following assays, differences between untreated and C. difficile-infected mice were evaluated for significance by using paired t-tests at P ≤ 0.05: diversity of the bacterial community examined by pyrosequencing; cell numbers obtained by analysing the flow cytometric data; mRNA expression for the UPR genes Gadd34 and Wars obtained by single gene quantitative RT-PCR; and protein expression or phosphorylation assessed by immunoblotting.

In a pilot study, we administered intravenous boluses of a monocl

In a pilot study, we administered intravenous boluses of a monoclonal anti-CD20 antibody (Rituximab) to five patients with active progressive disease, and the results (to be published elsewhere) were very encouraging. Vitiligo, in its primary form, is not a life-threatening disease; however, the cosmetic and, most importantly, the psychological effects of the condition might be overwhelming [38, 39]. Evidence-based therapeutic approaches have rarely been used in this disease, and we trust that our efforts will contribute towards this goal. No personal, institutional or corporate financial R428 in vivo conflicts are involved in the production and publication of this information. “
“Upon receptor activation, the myeloid

C-type lectin

receptor Mincle signals via the Syk-CARD9-Bcl10-MALT1 pathway. It does so by recruiting the ITAM-bearing FcεRI-γ. The related receptor macrophage C-type Lectin (MCL) has also been shown to be associated with Syk and to be dependent upon this signaling axis. We have previously shown that MCL co-precipitates with FcεRI-γ, but were unable to show a direct association, suggesting that MCL associates with FcεRI-γ via another molecule. Here, we have used rat primary cells and cell lines to investigate this missing link. A combination of flow cytometric and biochemical analysis showed that Mincle and MCL form heteromers on the cell surface. Furthermore, association with MCL and FcεRI-γ increased Mincle expression and enhanced phagocytosis of Ab-coated beads. The results presented in this http://www.selleck.co.jp/products/hydroxychloroquine-sulfate.html paper suggest that the Mincle/MCL/FcεRI-γ complex is the functionally optimal form for selleck chemicals these C-type lectin receptors on the surface of myeloid cells. Macrophage inducible C-type lectin (Mincle)

(also called CLEC4E) and macrophage C-type lectin (MCL) (also called CLEC4D) are single-pass transmembrane proteins that belong to the C-type lectin-like domain superfamily, and their genes lie adjacent to each other in the APLEC (antigen-presenting lectin-like complex) gene complex [1] in all species thus far examined. Mincle and MCL are expressed on cells of myeloid origin [2-8]. Mincle is normally expressed at low levels, but receptor levels are increased by exposure to different inflammatory signals [6, 7, 9]. Mincle has been shown to recognize the mycobacterial glycolipid trehalose-6,6-dimycolate (TDM, also called cord factor), present in the cell wall of some Mycobacterium species and considered as a virulence factor [10, 11]. Moreover, Mincle-deficient mice show increased mycobacterial burden following challenge with Bacillus Calmette-Guérin (BCG), suggesting that Mincle has an important in vivo role in the immune response to mycobacteria [12]. In addition, Mincle recognizes a number of pathogenic fungi, particularly Malassezia spp. [7, 8], and the endogenous ligand spliceosome-associated protein 130 released during cell necrosis [9].

trachomatis infection of an immortalized primary endocervical epi

trachomatis infection of an immortalized primary endocervical epithelial cell (A2EN). Our data suggest that NK cells lyse C. trachomatis-infected cells more efficiently at 34 hpi, when secondary differentiation to infectious EB is at an early stage, compared with a later stage (42 hpi). The increased activity of NK cells toward early stage C. trachomatis-infected cells may be beneficial to the host by reducing the levels of infectious EBs that can be released. We also investigated the effect of NK-mediated lysis of C. trachomatis-infected cells on the level of recoverable IFUs. Curiously,

although we observed that the recoverable IFUs decreased in the presence of NK cells, the magnitude this website of this decrease

was smaller than effects on cytolysis efficiency. NK cytolytic activity is primarily mediated by perforin, a pore-forming protein that acts as a channel for entry of granzymes (Reviewed in Lieberman, 2003), both of which are expressed in the NK cell line used here. Granzymes induce apoptosis selleck chemicals llc in target cells, consistent with the membrane blebbing and cytolysis we observed when C. trachomatis-infected A2EN cells were exposed to the NK cell line (NK92MI). Therefore, while NK lysis may deprive C. trachomatis of its intracellular niche, we hypothesize that C. trachomatis may be equipped with a mechanism to survive or escape NK cell-mediated host cell lysis. Thus, we believe that our data warrants further

investigation on the Anidulafungin (LY303366) impact of NK cell activity on C. trachomatis, as this may reveal novel survival mechanisms used by this bacterium against host innate immune response. This capacity of Chlamydia is reminiscent of recent observations made with the sexually transmitted pathogen Neisseria gonorrheae, which is able to escape/suppress the effects of neutrophil-associated oxidative bursts (Johnson & Criss, 2011). Interestingly, while our data and that of Hook et al. (2004) demonstrate increased susceptibility of C. trachomatis-infected cells to NK cell lysis, Mavoungou et al. (1999) have demonstrated that NK cells purified from the peripheral blood of C. trachomatis-infected patients have reduced IFNγ release and lytic capacity. These patients included those with genital and nongenital C. trachomatis serovars. Discrepancies among existing human studies on the role of NK cells in clearing C. trachomatis may reflect heterogeneity among NK cell receptors and their host-expressed ligands. Gene polymorphism in the site encoding the human activating NK cell receptor, NKG2D, has been shown to influence NK cell activity and susceptibility to some infectious diseases (Ma et al., 2010). Polymorphisms in human MICA have also been reported and may alter susceptibility to NK cell lysis (Ahmad et al., 2002; Karacki et al., 2004; Tosh et al., 2006). In light of the recent findings by Mei et al. (2009) that C.

Results:  Of 133 927 children, a total of 176 children had NS, wh

Results:  Of 133 927 children, a total of 176 children had NS, which incurred 508 hospital admissions. Nineteen percent of admissions were associated with major infections. Pneumonia was the most common infection (49%), followed by urinary tract infection (UTI), bacteraemia/sepsis, peritonitis and cellulitis. Pneumonia was the most common infection among children age younger than 10 years, whereas UTI was more common among children aged greater than 10 years. NS admission with infections www.selleckchem.com/JNK.html had

longer periods of hospital length of stay and higher hospital total costs compared to those without infections. Regression analysis reveals that younger age, regional hospitals, admission hospital located in middle and south areas and admission made Talazoparib in spring were associated with increased risk for developing major infections. Conclusions:  While 19% of childhood NS admissions were associated with major infections, young age, admissions made in spring, located in middle and south Taiwan and in regional hospitals were the major associated factors for infection. Age plays an important role in risk and types of infection. “
“Aim:  Cardiovascular disease is the most common cause of death in patients undergoing dialysis. The accuracy of multidetector computed tomography (MDCT) for detecting

coronary disease has not been determined, and little information is available regarding the performance of MDCT in patients undergoing dialysis. Methods:  Twenty-nine patients undergoing dialysis were analyzed and MDCT and coronary angiography (CAng) were performed consecutively. The coronary arteries were divided into four segments for analysis. We compared the significant stenosis lesions (≥50% luminal narrowing) identified by MDCT with those found by CAng. The total coronary artery calcium (CAC) score was determined by summing the individual lesion scores from each of the coronary branches. Results:  One hundred and sixteen

Lonafarnib chemical structure coronary artery branches in 29 patients were analyzed. The sensitivity, specificity, and positive and negative predictive values of MDCT for detecting significant coronary artery stenosis (≥50% stenosis) were 68%, 94%, 71% and 93%, respectively. The CAC scores were significantly higher in subjects with coronary artery disease (CAD) (514.0 ± 493.6 vs 254.3 ± 375.3, P = 0.05). The severe CAC score (>500) was related to the presence of significant CAD (P = 0.05) and the sensitivity and specificity for detecting significant CAD were 50% and 80%, respectively. Conclusion:  MDCT is a useful and non-invasive approach for detecting or excluding CAD in patients undergoing dialysis. “
“Aim:  To demonstrate that the evaluation of erythrocyte dysmorphism by light microscopy with lowering of the condenser lens (LMLC) is useful to identify patients with a haematuria of glomerular or non-glomerular origin.

The uptake levels of FSL-1 by the cells were analysed by using FC

The uptake levels of FSL-1 by the cells were analysed by using FCM as described above and assessed by change AZD6738 price in the mean fluorescence intensity (MFI). For an assay using a confocal laser scanning microscope (CLSM, LSM510 invert Laser Scan Microscope, Carl Zeiss,

Tokyo, Japan), a 2-ml suspension of the cells (1 × 105/ml) was added to each well of a six-well plate and incubated at 37° for 24 hr. Then the cells were washed three times at 37° with appropriate base medium and incubated with FITC-FSL-1. The cells were washed with PBS and reacted for 20 min with 50 μg/ml Alexa-Con A in PBS and then treated with PBS containing 3% (w/v) paraformaldehyde. To exclude non-specific incorporation of FSL-1, inhibition of FITC-FSL-1 uptake by unlabelled FSL-1 was also examined. Uptake of FITC-FSL-1 was measured in the presence of 9 or 35 μg/ml unlabelled FSL-1 under the experimental conditions described www.selleckchem.com/products/17-AAG(Geldanamycin).html above. To test the effects of Nys, CPZ and MbCD on FSL-1 uptake, RAW264.7 cells were treated for 30 min with various concentrations of the inhibitors as indicated in Fig. 4, which do not affect the viability of the cells.

After the cells had been washed with RPMI-1640 base medium, the uptake level of FSL-1 was determined as described above. A mouse clathrin heavy-chain-specific small interfering RNA (siRNA) (ACUAAGUAGCGAGAAAGGCtt) and negative control siRNA were purchased from Applied Biosystems (Foster City, CA). A 500-μl suspension of RAW264.7 cells (5 × 105 cells/ml) in a 24-well plate was prepared with antibiotic-free RPMI-1640 complete medium. The cells were incubated for 24 hr and then transfected with the siRNA (20 pmol/well) by using Lipofectamine 2000 according to the manufacturer’s instructions. The medium was exchanged at 5 hr and 24 hr after transfection, and the cells were examined for FSL-1 uptake at 48 hr after transfection. To confirm the effects of siRNAs, Real-Time TaqMan PCR was performed according to the manufacturer’s standard PCR protocol by using a

StepOne Real-Time PCR system (Applied Biosystems) with Rucaparib concentration specific pre-made TaqMan probes for mouse clathrin heavy chain (CGTTAATTGACCAGGTTGTACAGAC, Applied Biosystems) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH; GAACGGATTTGGCCGTATTGGGCGC, Applied Biosystems). For down-regulation of CD14 or CD36, their specific siRNA cocktails were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Eighty picomoles of siRNA or negative control siRNA were transfected into HEK293/CD14 or HEK293/CD36 using Metafectene (Biontex Laboratories GmbH). The effects of siRNA transfection on CD14 and CD36 expression level were confirmed by FCM analysis. HEK293 cells were prepared in a six-well plate (5 × 105/well). Then the cells were transiently transfected with CD14 (1 or 2 μg) and/or CD36 (1 or 2 μg). After a 48-hr incubation, FITC-FSL-1 (100 μg/ml) was added and the uptake level was determined.

3) Disease development in IPF is thought to result

3). Disease development in IPF is thought to result selleck kinase inhibitor from repetitive injury to epithelial cells and an abnormal fibrotic response. Proinflammatory mediators, such as IL-1β, are known to promote fibrosis, but can be regulated by the receptor antagonist IL-1Ra. In the present study, we found that the ratio between IL-1Ra and IL-1β was decreased in both serum and BALF of IPF patients compared to healthy controls. Furthermore, we showed that one SNP in IL1RN, rs2637988, associated with susceptibility

to IPF and with the IL-1Ra/IL-1β ratio in BALF. A predisposing effect of genetic variation in IL1RN was described previously by Whyte et al., who found an increased risk of fibrosing alveolitis in an Italian and a British population [6]. They investigated the IL1RN + 2018 SNP, which in the Caucasian Hapmap panel is in complete linkage Cell Cycle inhibitor disequilibrium with our tag rs408392 (r2 = 1). In our study, rs408392 was not the most significantly associated SNP, although carriership of allele 2 of rs408392 was more common in patients with IPF (P = 0·07). In other studies the variable number of tandem repeats (VNTR) in intron 2 of IL1RN was investigated and found to be in linkage disequilibrium with the IL1RN + 2018 SNP. However, both a small Australian [7] and an independent Czech cohort [12] did not reveal any association between the VNTR and

IPF susceptibility [13]. Functional effects of IL1RN + 2018 alleles have been demonstrated by Carter et al. They showed that IL1RN + 2018 allele 2 not only correlated with Racecadotril the susceptibility to ulcerative colitis, but also to a significantly decreased ratio between the protein and mRNA content of IL-1Ra and total IL-1 in the colonic mucosa [14]. Although we found the same trend as reported in the Italian and British cohorts, our data suggest that carriership

of the G allele of IL1RN rs2637988 is associated more strongly with IPF. Carriership of the G-allele is higher in IPF patients (75%) compared to controls (61%), P = 0·02. In addition, we showed that IPF patients carrying the rs2637988 G-allele had a significantly lower IL-1Ra/IL-1β ratio in BALF, suggesting a relative shortage of IL-1Ra compared to IL-1β. This implies that presence of the G allele has a pathogenic role in IPF. The balance between IL-1 and IL-1Ra seems crucial in inflammatory diseases [15–18]. Although IPF is not primarily an inflammatory disease, IPF is characterized by high levels of inflammatory parameters. The balance between IL-1 and IL-1Ra has rarely been studied in IPF, but extensively in inflammatory diseases. In inflammatory bowel disease, changes in the IL-1Ra/IL-1β ratio have also been studied. Protein levels in the colonic mucosa of IL-1Ra, IL-1α and IL-1β were higher than in controls, but the ratio between IL-1Ra and total IL-1 was decreased significantly [14,19].

Splenic tissue sections (8 μm) were mounted on precooled slides,

Splenic tissue sections (8 μm) were mounted on precooled slides, stored unfixed at −70°C and in situ hybridization

performed as described previously 46. Hybridized digoxigenin-labeled anti-sense RNA probes (SP6/T7 labeling kit, Roche) were detected with alkaline phosphatase-conjugated anti-digoxigenin Fab (Roche), and developed with BCIP/NBT (Promega). In situ hybridization for each RNA probe was performed in two independent experiments. Specificity of hybridization was controlled by using sense RNA probes. The MI-503 authors thank H. Schliemann (DRFZ) for technical support and R. S. Jack for critical discussion. This work was supported by the BMBF (Verbundprojekt 0312106). The DRFZ is supported by the Berlin Senate of Research and Education. Conflict of interest: The authors declare no financial or commercial conflict of interest. Detailed facts of importance to specialist readers are published as ”Supporting Information”.

Such documents are peer-reviewed, PF-01367338 supplier but not copy-edited or typeset. They are made available as submitted by the authors. “
“This issue of Infancy marks the transition to a new editorial team. The previous team, led by editor Martha Ann Bell at Virginia Tech University, will be a hard act to follow; at last report, manuscript turnaround was 57 days and Infancy’s impact factor had been raised to over 1.9. Many of the papers in this issue were accepted by the previous team (which included Celia Brownell, Thierry Nazzi, Lisa Oakes, and Douglas Teti), and the next few issues will feature a mix of papers from the teams as the transition continues.

I am honored to have been chosen to serve as Infancy’s new editor, and I am pleased to announce a team featuring three new associate editors, Suzanne Curtin (University of Calgary), Ronny Geva (Bar Ilan University), and Catherine Tamis-LeMonda (New York University). Megan Blossom here at the University of Kansas will serve as our Editorial Assistant. In this term, we will look to maintain the accomplishments and capitalize on the momentum of the previous team. However, we will look to initiate some changes to the journal as well. First, we hope to publish more papers in a more timely fashion by setting length limits for submissions; look for word count limits on submissions in author instructions on the Tacrolimus (FK506) Wiley website by the start of the calendar year 2014. Second, we will look to encourage and promote more translational science in Infancy over our term; while maintaining its traditional emphases (i.e., early normative cognitive, language, social, and affective development) and we hope to extend the scope and impact of Infancy by opening it up to rigorous work in (for example) early intervention and neurodevelopmental disorders in infancy. We are grateful to the Martha Ann’s team for their service to the Society, and we look forward to the opportunity to serve and help shape the field of infant studies for the next 5 years.

Most of these can be attributed to the impaired metabolism of bra

Most of these can be attributed to the impaired metabolism of brain biogenic amines. To gain new insights into the dithiocarbamates and their effects on neurotransmitter systems, an in vivo experimental model based on daily injections of DEDTC in adult mice for 7 days was established. To this end, the concentrations of the three major brain monoamines, dopamine (DA), noradrenaline (NA) and serotonin (5-HT) were

measured in whole brain extracts with high-performance liquid chromatography (HPLC). The levels of D2 dopamine receptor (D2R) were evaluated by Western blot and by immunohistochemical techniques the cell pattern of tyrosine hydroxylase (TH), dopa beta hydroxylase (DBH) and choline acetyltransferase ChAT) were analysed. selleck compound A significant reduction in DA and 5-HT levels was observed, whereas NA was not affected. Moreover, decreases in D2R levels, as well as

in enzymes such as TH, DBH and ChAT, were found. Our data suggest that DEDTC provokes alterations in biogenic amines and in different substrates of neurotransmitter systems, which could explain some of the neurobehavioural effects observed in patients treated with disulphiram. “
“T. N. Phoenix, D. S. Currle, G. Robinson and R. J. Gilbertson (2012) Neuropathology and Applied Neurobiology38, 222–227 Developmental origins of neural tumours: old idea, new approaches The recent convergence of pathology, cancer research and basic neurobiology disciplines is providing unprecedented

insights to the origins of brain tumours. This new knowledge holds buy GS-1101 great promise for patients, transforming the way we view and develop new treatments for these devastating diseases. “
“Filaments made Benzatropine of hyperphosphorylated tau protein are encountered in a number of neurodegenerative diseases referred to as “tauopathies”. In the most prevalent tauopathy, Alzheimer’s disease, tau pathology progresses in a stereotypical manner with the first lesions appearing in the locus coeruleus and the entorhinal cortex from where they appear to spread to the hippocampus and neocortex. Propagation of tau pathology is also characteristic of argyrophilic grain disease, where the tau lesions appear to spread throughout distinct regions of the limbic system. These findings strongly implicate neuron-to-neuron propagation of tau aggregates. Isoform composition and morphology of tau filaments can differ between tauopathies suggesting the existence of conformationally diverse tau strains. Altogether, this points to prion-like mechanisms in the pathogenesis of tauopathies. “
“Pilomyxoid astrocytoma (PMA) is a newly identified variant of pilocytic astrocytoma (PA). We report three cases of PMA with comparison to seven cases of PA in terms of their clinicopathological features.

However, tumor progression and eventual invasion of the host is a

However, tumor progression and eventual invasion of the host is also dependent on the host response in terms of inflammation and antitumor immunity.

This host response provides both a tumor-promoting environment and an immune barrier to tumor progression that the tumor needs to neutralize or overcome in order to progress (reviewed in [80-82]). Indeed for colorectal carcinoma and other types of cancer, the presence of adaptive immune cells within the tumor has been shown to be a better predictor of tumor progression and prognosis than traditional or molecular tumor staging [83]. Tumors have been shown GSK1120212 mw not only to originate in inflamed JAK inhibitor tissues due to infections, but some human tumors develop in sterile chronic inflammation, due to mechanical, chemical, radiation, or other types of injury, or due to genetic pathology. For example, chronic indwelling of urinary catheters has been shown to be associated with bladder carcinoma [84], chronic exposure to asbestosis is associated with lung cancer and mesothelioma (chemical) [85], and secondary pancreatitis resulting from a mutation in the trypsinogen gene has been associated with pancreatic carcinoma

[86]. Inflammation has been proposed to be involved in the promotion of cancer, in part through the production of reactive oxygen and nitrogen species; both species induce the formation of DNA cross-links, single- or double-strand breaks that can drive genomic instability and mutations within oncogenes and tumor suppressor genes [80, 87-89]. In addition, clear experimental evidence indicates

that inflammation provides a tumor-promoting environment in which stromal cells and infiltrating inflammatory hematopoietic cells, such as macrophages, produce growth and angiogenic factors as well as tissue remodeling enzymes [80, 90-94] (Fig. 1). Activation of certain oncogenes, such as RET, Hras and Kras, has been shown to NADPH-cytochrome-c2 reductase induce, both in the transformed cells as well as in surrounding tissue, an intrinsic inflammation with a secretory pattern; this pattern is reminiscent of that observed in senescent cells, of inflammatory mediators and chemokines that attract inflammatory hematopoietic cells, thus initiating and amplifying the inflammatory response [95-99]. Inflammation also causes infiltration by bone-marrow-derived tumor-associated macrophages and monocyte-derived myeloid cell subsets [100], which perform a critical protumorigenic function in creating the tumor environment by remodeling healthy tissue to accommodate the expanding tumor, increasing angiogenesis and suppressing antitumor T-cell responses [101, 102].

1% sodium azide, and then stained with the amine-reactive LIVE/DE

1% sodium azide, and then stained with the amine-reactive LIVE/DEAD fixable violet dead cell

stain kit (Molecular Probes, Invitrogen) 47 and with allophycocyanin (APC)-conjugated anti-CD4+ mAb (BD Pharmingen, San Josè, CA, USA) in incubation buffer (PBS-1% FCS-0.1% Na azide) for 30 min at 4°C. Subsequently, PBMC were washed, permeabilized (Cytofix/Cytoperm Kit, BD Pharmingen) according to the manufacturer’s instructions and stained for intracellular cytokines with anti-IFN-γ-PE, anti-IL-2-FITC Y27632 and TNF-α-PECy7, or isotype-matched control mAb. All mAb were from BD Pharmingen. Cells were washed, fixed in 1% paraformaldehyde and at least 250 000 lymphocytes were acquired using a modified FACS Aria (BD Biosciences), following gating according to forward and side scatter plots. FACS plots were analysed using FlowJo software (version 6.1.1; Tree Star, Ashland, OR, USA). Nonviable cells were excluded using a dump channel versus CD4+. Percent frequencies of the different combinations of IFN-γ, IL-2 and TNF-α-positive cells following antigenic stimulation were calculated within the total population of CD4+ T cells and background values subtracted (as determined from the medium alone control). Nonspecific background was extremely low when more GSK2126458 than one cytokine was examined. A cutoff of 0.01% was used as described previously

48; values below this were set to zero. PBMC were stimulated in IMDM (Invitrogen, Breda, The Netherlands) containing 10% pooled human serum and ESAT-6+CFP-10 peptides, tested in pools containing 1 μg/mL per peptide. Cells were cultured in a humidified incubator at 37°C with 5% CO2 for 6 days, the last 18 h in the presence of 5 μg/mL Brefeldin A (Sigma, Zwijndrecht, The Netherlands). Intracellular staining was performed using intrastain reagents (Dako cytomation, Heverlee,

Belgium). Ab used were CD3−APC-Cy7, CD4+-PE-Cy7, CD8+-Am Cyan, IFN-γ-Alexa 700, IL-2-PE and TNF-α-APC (all from BD Biosciences, Alphen aan den Rijn, The Netherlands). Data were acquired on a BD LSRII flow cytometer using FACSDiva software (BD Biosciences) and analysed using FlowJo software (Tree Star). Graphical representations were made using Pestle and Spice software, software provided free of charge by the National Institute of stiripentol Allergy & Infectious Disease (Bethesda, MD, USA), written in collaboration with Dr. Mario Roederer, Senior Investigator of the ImmunoTechnology section of the Vaccine Research Center at the National Institute of Allergy and Infectious Diseases. Median and interquartile range of data were calculated and Mann–Whitney U-test was used to compare medians. Chi-square testing was used for dichotomous (positive/negative) measures. Values of p<0.05 were considered significant. Data were analyzed using statistical software SYSTAT 11 (Systat Software) or Graph Pad Prism (4.02) (Graph Pad Software). The authors acknowledge Dr.